Busch Lab

ZMP

NP_571708.1

Ensembl ID:
ENSDARG00000014891
Description:
roundabout homolog 2 [Source:RefSeq peptide;Acc:NP_571708]
Human Orthologue:
ROBO2
Human Description:
roundabout, axon guidance receptor, homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:10250]
Mouse Orthologue:
Robo2
Mouse Description:
roundabout homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1890110]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa42608 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24995 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14991 Nonsense Available for shipment Available now
sa30686 Nonsense Mutation detected in F1 DNA Not yet available
sa10275 Essential Splice Site Available for shipment Available now
sa35976 Nonsense Mutation detected in F1 DNA Not yet available
sa35975 Nonsense Mutation detected in F1 DNA Not yet available
sa35974 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6395 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42608
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014877 Essential Splice Site 56 1387 2 27
ENSDART00000099344 None None 111 None 3
ENSDART00000099346 Essential Splice Site 56 736 2 15
ENSDART00000129511 Essential Splice Site 56 1391 2 28
Genomic Location (Zv9):
Chromosome 15 (position 37974528)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 39251708
GRCz11 15 39098469
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATATGAAGTGTCACAGAAGCTGTAAAGTTTCATTGTTTTTTCTCGTTTA[G/T]ATCCGTGGAGGGAAGCTGATGATCTCTAACACCAGGAAAAGCGACGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24995
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014877 Essential Splice Site 233 1387 6 27
ENSDART00000099344 None None 111 None 3
ENSDART00000099346 Essential Splice Site 229 736 5 15
ENSDART00000129511 Essential Splice Site 233 1391 6 28
Genomic Location (Zv9):
Chromosome 15 (position 37949720)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 39276459
GRCz11 15 39123061
KASP Assay ID:
554-7348.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAAAGGGAACCCGCAGCCGGCAGTCTTCTGGCAGAAAGAAGGAAGTCAG[G/A]TAAGGACACATCTTTCTCTTTCATTATTCCCCTAACCTACAGTACTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14991
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014877 Nonsense 341 1387 8 27
ENSDART00000099344 None None 111 None 3
ENSDART00000099346 Nonsense 337 736 7 15
ENSDART00000129511 Nonsense 341 1391 8 28
Genomic Location (Zv9):
Chromosome 15 (position 37934557)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 39290918
GRCz11 15 39137520
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACCWGTCCCAACCAWCAGCTGGCTGAAGGACGGGGTCAGTCTGCTGGGC[A/T]AARACCCTCGGATGTCCCTGCAAGACCTCGGCAGCCTGCAGATCAAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30686
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014877 Nonsense 348 1387 8 27
ENSDART00000099344 None None 111 None 3
ENSDART00000099346 Nonsense 344 736 7 15
ENSDART00000129511 Nonsense 348 1391 8 28
Genomic Location (Zv9):
Chromosome 15 (position 37934536)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 39290939
GRCz11 15 39137541
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTGAAGGACGGGGTCAGTCTGCTGGGCAAAGACCCTCGGATGTCCCTG[C/T]AAGACCTCGGCAGCCTGCAGATCAAGGGTTTACGGGTGAGCCTAAACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10275
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014877 Essential Splice Site 387 1387 9 27
ENSDART00000099344 None None 111 None 3
ENSDART00000099346 Essential Splice Site 383 736 8 15
ENSDART00000129511 Essential Splice Site 387 1391 9 28
Genomic Location (Zv9):
Chromosome 15 (position 37932122)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 39293353
GRCz11 15 39139955
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAAGTTCTAGTGGGGAAACAWCATGGAGTGCTTTCTTGGAGGTCAAAGG[T/C]ACTTGTTTGAAACTGTACACATTGTWAGTAATTTGGTTCTTCTAGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35976
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014877 Nonsense 552 1387 13 27
ENSDART00000099344 None None 111 None 3
ENSDART00000099346 Nonsense 548 736 12 15
ENSDART00000129511 Nonsense 552 1391 13 28
Genomic Location (Zv9):
Chromosome 15 (position 37926428)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 39299025
GRCz11 15 39145627
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCCCTCAGGTTGACCGCCAGTCTCAGTTCATCCAGGGCTACAGGGTTT[T/A]GTACAGGCAGATGTCAGGCCTGTCTTCTCCAGGAGCCTGGCAAACTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35975
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014877 Nonsense 649 1387 14 27
ENSDART00000099344 None None 111 None 3
ENSDART00000099346 Nonsense 645 736 13 15
ENSDART00000129511 Nonsense 650 1391 14 28
Genomic Location (Zv9):
Chromosome 15 (position 37915123)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 39310246
GRCz11 15 39156848
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAACAGCACATCTATTAGCATCTCCTGGGACCCTCCGCCTGCAGAACAC[C/T]AGAACGGCATCATACAGGAGTACAAGGTGAACAACAATTAACACTTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35974
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014877 Essential Splice Site 715 1387 15 27
ENSDART00000099344 None None 111 None 3
ENSDART00000099346 Essential Splice Site 711 736 14 15
ENSDART00000129511 Essential Splice Site 716 1391 15 28
Genomic Location (Zv9):
Chromosome 15 (position 37912972)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 39312531
GRCz11 15 39159133
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAGCGCCGGGGTCGGAGTGAAGAGCGAACCACAAACCATCATCATTGG[T/A]ACCAGAAATGTTTAATTCTCAGCTTTTTATCTGTCAAACTCAACACTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6395
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014877 Essential Splice Site 799 1387 18 27
ENSDART00000099344 None None 111 None 3
ENSDART00000099346 None None 736 None 15
ENSDART00000129511 Essential Splice Site 800 1391 18 28
Genomic Location (Zv9):
Chromosome 15 (position 37898692)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 39327025
GRCz11 15 39173627
KASP Assay ID:
554-4488.1 (used for ordering genotyping assays)
KASP Sequence:
ACCCCAGTGACGTTCCAGCGTGTTGATGGAGGCTTGATGAGCAACGGGAG[G/A]TAAGATTCCTGTCATCTGCTCTCTCGTTTCCCCTTGTTWTTCCTCAGCAT
Associated Phenotype:
Not determined