Busch Lab

ZMP

CHD1

Ensembl ID:
ENSDARG00000014878
Description:
chromodomain helicase DNA binding protein 1 [Source:HGNC Symbol;Acc:1915]
Human Orthologue:
CHD1
Human Description:
chromodomain helicase DNA binding protein 1 [Source:HGNC Symbol;Acc:1915]
Mouse Orthologue:
Chd1
Mouse Description:
chromodomain helicase DNA binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:88393]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa34847 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21667 Nonsense Available for shipment Available now
sa5826 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34847
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085727 Essential Splice Site 587 1778 12 36
Genomic Location (Zv9):
Chromosome 10 (position 8541545)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6567901
GRCz11 10 6569110
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGTTGAACATTCTTCTGACTACATATGAAATTCTGCTGAAGGATAAG[G/T]TATAATTCAAGCCAAATTCATCTTTTAAAACACTGAGAAACTTATTTTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4361
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085727 Essential Splice Site 587 1778 12 36
Genomic Location (Zv9):
Chromosome 10 (position 8541546)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6567900
GRCz11 10 6569109
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAGTTGAACATTCTTCTGACTACATATGAAATTCTGCTGAAGGATAAGG[T/C]ATAATTCAAGCCAAATTCATCTTTTRAAACACTGAGAAACTTATTTTAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3765
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085727 Nonsense 711 1778 14 36
Genomic Location (Zv9):
Chromosome 10 (position 8544582)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6564864
GRCz11 10 6566073
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCCAAGGTGGAACAGATCCTCCGGGTGGAGATGAGCGCGGTTCAGAAA[C/T]AATACTACAAGTAAGACAACCACATTCATATAGAMTACAGTACAGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21667
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085727 Nonsense 846 1778 18 36
Genomic Location (Zv9):
Chromosome 10 (position 8551589)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6557857
GRCz11 10 6559066
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAACGTGAAATTTGTTGACGTGATTTCTTTGACTTTGCAGGATTTCTG[T/A]TTCCTGTTGTCCACACGAGCGGGTGGTCTGGGCATTAACCTGGCCTCTGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2580
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085727 Essential Splice Site 1007 1778 21 36
ENSDART00000085727 Essential Splice Site 1007 1778 21 36
Genomic Location (Zv9):
Chromosome 10 (position 8557413)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6552033
GRCz11 10 6553242
KASP Assay ID:
2260-2910.1 (used for ordering genotyping assays)
KASP Sequence:
TGACCCAGGACCATCGACTGTAGGAGAAGAGCTGCTCTCACAGTTTAAGG[T/A]ATTTTCTGGCRTTTAAAACRTATTATTAATGATACGTTGGACTTTCAGTY
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18978
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085727 Essential Splice Site 1007 1778 21 36
ENSDART00000085727 Essential Splice Site 1007 1778 21 36
Genomic Location (Zv9):
Chromosome 10 (position 8557413)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6552033
GRCz11 10 6553242
KASP Assay ID:
2260-2910.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACCCAGGACCATCGACTGTAGGAGAAGAGCTGCTCTCACAGTTTAAGG[T/A]ATTTTCTGGCATTTAAAACGTATTATTAATGATACGTTGGACTTTCAGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2550
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085727 Nonsense 1094 1778 23 36
Genomic Location (Zv9):
Chromosome 10 (position 8562036)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6547410
GRCz11 10 6548619
KASP Assay ID:
554-2859.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGCAGGAACAGACGATACTCTGCTTCAGACAGTGATTCAGTCTCTGAC[C/T]GAAAGAGGCCCAAGAAGCGTGGAAGACCTCGAACTATCCCAAGAGAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5826
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085727 Nonsense 1577 1778 33 36
Genomic Location (Zv9):
Chromosome 10 (position 8579660)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6529786
GRCz11 10 6530995
KASP Assay ID:
554-3680.1 (used for ordering genotyping assays)
KASP Sequence:
AATTCGATGCAAGGAAACTGCATAAACTGTAYAAGCACGCTATYAAGAAA[C/T]GACAAGAAAATGCTCAGGTATGAACACATTATTATTTTTACATTTCTGTT
Associated Phenotype:
Not determined