Busch Lab

ZMP

zgc:136560

Ensembl ID:
ENSDARG00000014875
ZFIN ID:
ZDB-GENE-060519-5
Description:
abl interactor 2 [Source:RefSeq peptide;Acc:NP_001038762]
Human Orthologue:
ABI2
Human Description:
abl-interactor 2 [Source:HGNC Symbol;Acc:24011]
Mouse Orthologue:
Abi2
Mouse Description:
abl-interactor 2 Gene [Source:MGI Symbol;Acc:MGI:106913]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa20645 Essential Splice Site Available for shipment Available now
sa16444 Essential Splice Site Available for shipment Available now
sa18833 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20645
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065471 Essential Splice Site 154 461 3 9
Genomic Location (Zv9):
Chromosome 6 (position 9893971)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 9747778
GRCz11 6 9983317
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAAGCCCATTGACTACAGTCTGCTGGATGACGTAGGCCATGGCGTAAAG[G/T]TAGGCATCAAGCCAGTCTCTATGTGTGAGTTCATGTTGTTATATTCATGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8221
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065471 Essential Splice Site 339 461 7 9
Genomic Location (Zv9):
Chromosome 6 (position 9914374)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 9768181
GRCz11 6 10003720
KASP Assay ID:
2259-7190.1 (used for ordering genotyping assays)
KASP Sequence:
CATGATACAAAACCAGCTTAATGGAGGGCCACACTACAACCAAAACCAAG[G/A]TAAAGACCACACAGCCCTCTGTTGTGTAATCAAAGTTATCTATAAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16444
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065471 Essential Splice Site 340 461 7 9
ENSDART00000065471 Essential Splice Site 340 461 7 9
Genomic Location (Zv9):
Chromosome 6 (position 9914375)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 9768182
GRCz11 6 10003721
KASP Assay ID:
2259-7191.1 (used for ordering genotyping assays)
KASP Sequence:
ATGATACAAAACCAGCTTAATGGAGGGCCACACTACAACCAAAACCAAGR[T/G]AAAGACCACACAGCCCTCTGTTGTGTAATCAAAGTTATCTATAAGGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18833
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065471 Essential Splice Site 340 461 7 9
ENSDART00000065471 Essential Splice Site 340 461 7 9
Genomic Location (Zv9):
Chromosome 6 (position 9914375)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 9768182
GRCz11 6 10003721
KASP Assay ID:
2259-7191.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGATACAAAACCAGCTTAATGGAGGGCCACACTACAACCAAAACCAAGG[T/G]AAAGACCACACAGCCCTCTGTTGTGTAATCAAAGTTATCTATAAGGTTTC
Associated Phenotype:
Not determined