Busch Lab

ZMP

hprt1l

Ensembl ID:
ENSDARG00000014866
ZFIN ID:
ZDB-GENE-040625-17
Description:
hypoxanthine phosphoribosyltransferase 1, like [Source:RefSeq peptide;Acc:NP_001002056]
Human Orthologues:
HPRT1, PRTFDC1
Human Descriptions:
hypoxanthine phosphoribosyltransferase 1 [Source:HGNC Symbol;Acc:5157]
phosphoribosyl transferase domain containing 1 [Source:HGNC Symbol;Acc:23333]
Mouse Orthologue:
Hprt
Mouse Description:
hypoxanthine guanine phosphoribosyl transferase Gene [Source:MGI Symbol;Acc:MGI:96217]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa12442 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12442
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025494 Nonsense 120 215 4 9
ENSDART00000114508 Nonsense 120 217 4 8
Genomic Location (Zv9):
Chromosome 25 (position 38105229)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36507018
GRCz11 25 37077907
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAATGACCAGTCCACCAACTGTGTGAAGGTGATCGGRGGAGACGAGCTAT[C/A]GGCCCTCGCTGGAAAAGTCAGTCTGGAGTTTGTTKGTTTTGGGWTGTGCT
Associated Phenotype:
Not determined