Busch Lab

ZMP

drd2l

Ensembl ID:
ENSDARG00000014858
ZFIN ID:
ZDB-GENE-030910-1
Description:
dopamine receptor D2 like [Source:RefSeq peptide;Acc:NP_922917]
Human Orthologue:
DRD2
Human Description:
dopamine receptor D2 [Source:HGNC Symbol;Acc:3023]
Mouse Orthologue:
Drd2
Mouse Description:
dopamine receptor D2 Gene [Source:MGI Symbol;Acc:MGI:94924]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36274 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28762
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002856 Essential Splice Site 138 437 2 7
Genomic Location (Zv9):
Chromosome 16 (position 57792775)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 54408038
GRCz11 16 54266493
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGTGCACCGCCAGCATCCTCAACCTGTGCGCCATCAGCATCGACAGG[T/C]GAAACCAGACTTCATACACAGTTTTACTACTACAGTACCTGGAACCCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36274
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002856 Essential Splice Site 183 437 3 7
Genomic Location (Zv9):
Chromosome 16 (position 57801711)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 54416974
GRCz11 16 54275429
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTCCTTCGCCATCTCCTGCCCACTGCTGTTCGGCCTCAACAACACTG[G/A]TACACACACACACACATAGCCGACCTTTCTTATGAGCAAACTAAGTGGCT
Associated Phenotype:
Not determined