Busch Lab

ZMP

cacna2d1a

Ensembl ID:
ENSDARG00000014804
ZFIN ID:
ZDB-GENE-041210-215
Description:
voltage-dependent calcium channel subunit alpha-2/delta-1 [Source:RefSeq peptide;Acc:NP_001038425]
Human Orthologue:
CACNA2D1
Human Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 1 [Source:HGNC Symbol;Acc:1399]
Mouse Orthologue:
Cacna2d1
Mouse Description:
calcium channel, voltage-dependent, alpha2/delta subunit 1 Gene [Source:MGI Symbol;Acc:MGI:88295]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa6941 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40280 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40279 Nonsense Mutation detected in F1 DNA Not yet available
sa7551 Missense Mutation detected in F1 DNA Not yet available
sa45174 Nonsense Mutation detected in F1 DNA Not yet available
sa8955 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6941
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014440 Essential Splice Site 36 1069 2 38
ENSDART00000105967 Essential Splice Site 36 1090 2 39
Genomic Location (Zv9):
Chromosome 4 (position 18790033)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19866639
GRCz11 4 19855615
KASP Assay ID:
554-4992.1 (used for ordering genotyping assays)
KASP Sequence:
CKTTTGACTGTTGTTCAWCACTGATCATGTGATTTGCCCTTCATGTTTGC[A/T]GGACCCGGAAATGGGCAGAAAAGATGCAGGAAGATCTCGTGCAGTTGATY
Long Flanking Sequence:
GACATCCATTGAAATGATGATTTAGCTAGAAATTGTCTATTTTAATTGGATGATTTCACTGTGTTTTTATTGTTATCACTTAGAGTAATGTTGATTAGCAGGACTGTTCAGAGGTTGTTTCTTTTCATTTTTTAAAAAACAATTGAAGGTATAGCCCACCCCCCCAAAAAATGTTATTTCATCATTTACTCACCCATTACTGGTTTCACATTTTTGTTGAACACAAAAGAAAATGTTTTGAAAAATACTGAAAGCTTGTAGGCAGCCATTGACTTCCATTGTTGTTTTCTCTGCTGCGGATGCCAATGGTTACAGGTTTCATCAAAATATATTCTTTAAAAAAAATCATAAAGGTATGAAACCACTTGAGGGTGAGTAAATAATGAGTATAATTAAATTTTTAGGTGAACTATCCCTTTAGTGAACAATGAAAGAAATCATCAATGAAAGCTTTTGACTGTTGTTCAACACTGATCATGTGATTTGCCCTTCATGTTTGC[A/T]GGACCCGGAAATGGGCAGAAAAGATGCAGGAAGATCTCGTGCAGTTGATCGATTCTGAGAGCGGTATAAAAGAGCTCAAAAAAGTAAGACCGCACAACTGTTTTGTACTATGTAAAATCAACTGTACAGTATGCACTCAGTAATACAGTATGCATCGCTGAATATGTTTTGGCAACAGTTTGGCATGGTCTGATTCAACACTTTTGTCTAAAAAAATCTTTGTTTTCTGTGTCATTATGACTATTTTACAAACAATAATTAGTAAAATGTTGGTTAAAAGTCTTGTTTTCTTAACAAGGGTGCATTTATTTCATGTGAATAATTATGATGTGCTTCATTTTCATGGTCGATTCTGATTGCTGTACTAAATAGAGTGAATGCAGTCGAAGTCAGAATTATCAGCCCCCCTGTTTATATTTTCCCCCATTTTTTGTTTAATGGATAGAAGATTTTTCAACACATTTCTAATCATAATAGTTTTAATAACTCATTTCTAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40280
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014440 Essential Splice Site 63 1069 2 38
ENSDART00000105967 Essential Splice Site 63 1090 2 39
Genomic Location (Zv9):
Chromosome 4 (position 18789948)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19866554
GRCz11 4 19855530
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCGTGCAGTTGATCGATTCTGAGAGCGGTATAAAAGAGCTCAAAAAAG[T/A]AAGACCGCACAACTGTTTTGTACTATGTAAAATCAACTGTACAGTATGCA
Long Flanking Sequence:
TAATGTTGATTAGCAGGACTGTTCAGAGGTTGTTTCTTTTCATTTTTTAAAAAACAATTGAAGGTATAGCCCACCCCCCCAAAAAATGTTATTTCATCATTTACTCACCCATTACTGGTTTCACATTTTTGTTGAACACAAAAGAAAATGTTTTGAAAAATACTGAAAGCTTGTAGGCAGCCATTGACTTCCATTGTTGTTTTCTCTGCTGCGGATGCCAATGGTTACAGGTTTCATCAAAATATATTCTTTAAAAAAAATCATAAAGGTATGAAACCACTTGAGGGTGAGTAAATAATGAGTATAATTAAATTTTTAGGTGAACTATCCCTTTAGTGAACAATGAAAGAAATCATCAATGAAAGCTTTTGACTGTTGTTCAACACTGATCATGTGATTTGCCCTTCATGTTTGCAGGACCCGGAAATGGGCAGAAAAGATGCAGGAAGATCTCGTGCAGTTGATCGATTCTGAGAGCGGTATAAAAGAGCTCAAAAAAG[T/A]AAGACCGCACAACTGTTTTGTACTATGTAAAATCAACTGTACAGTATGCACTCAGTAATACAGTATGCATCGCTGAATATGTTTTGGCAACAGTTTGGCATGGTCTGATTCAACACTTTTGTCTAAAAAAATCTTTGTTTTCTGTGTCATTATGACTATTTTACAAACAATAATTAGTAAAATGTTGGTTAAAAGTCTTGTTTTCTTAACAAGGGTGCATTTATTTCATGTGAATAATTATGATGTGCTTCATTTTCATGGTCGATTCTGATTGCTGTACTAAATAGAGTGAATGCAGTCGAAGTCAGAATTATCAGCCCCCCTGTTTATATTTTCCCCCATTTTTTGTTTAATGGATAGAAGATTTTTCAACACATTTCTAATCATAATAGTTTTAATAACTCATTTCTAACAACTTAATATTTTTATCGTTGCCAGTTGATGACAGTAAATAATATTTCACTAGATATTTTTCAAGACACTTCTATACAGCTTAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40279
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014440 Nonsense 186 1069 7 38
ENSDART00000105967 Nonsense 186 1090 7 39
Genomic Location (Zv9):
Chromosome 4 (position 18748510)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19825116
GRCz11 4 19814092
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTTTCTGTGTTTATTTCCACAGCCACTATCATCCTAAATGAGCTGAACT[G/A]GACGGCGGCTCTGGATGACGTCTTCAGGAAGAACAAAGAGGACGATCCAT
Long Flanking Sequence:
CTGAACTTAAACTAAAAATGGATGTTGTGCTGACTATATTGGATCCCACAGTAATGACACACCAAACAAGAGTGAATAACAATTTTTATTAAGTGTACACTATTGCTTTTTCTGTTATTACGTTGATATGTACTCAGTATTTATAAGTGTTTAGCCTAAATAACAGCAGTGTCCATCTATGAATGATGTAGTCTGTCAAATATACATGCATATAGGCACATAACTGTCCTTCCTTTCCGACTTTGATTTTGTTAATGTGCAAAACTGTCAGCCAATCACACTAGTGTGCATTTACTTTTGCATTTACAATTTACTACAACCAATCAAACAGTGTGTTCAGATTTCCTATTGCTTATTAATCATGATGTTTATTATTGTAAAAGTCTTGATAACATGCATAGCTCAGAGAAGAGTCTCATATATGTATCTTCAGATGGGGATTATTGTATGCGTTTCTGTGTTTATTTCCACAGCCACTATCATCCTAAATGAGCTGAACT[G/A]GACGGCGGCTCTGGATGACGTCTTCAGGAAGAACAAAGAGGACGATCCATCGCTTCACTGGCAGGTGTTCGGCAGTGCAACAGGCCTGGCACGATATTTCCCAGGTAAAGTACTGGAAAACAAAGGCTGTTCTAAATAATGCGTTTACAGTTGGCAAAATAATTTCACTGTTGATTGTGGTATGTGTGATTAGCCATCGACTAATGAGAGAAAATGAACACAATGAACGGAGACAGAAAACAAAAAACAGGAAGTCAAATGCACTAACATAGCCAAAGTCTTGCATATGCAGGAGTGAAAACTGTTAAACTTTTTTGTTAATATTAATTACTCAATCAAAATGTAAATGAATTATGAAATGCATTTAAATACTTACTATCAAAAACTGCTACTGTTCTAATGCTTTTGAAGACATGTTTCATGATACTATACTTATATTAAAGAAATGATTGTTACATAAGTATTTTACCTACTTTAATTACTCACTGTCCACTTTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7551
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014440 Missense 289 1069 10 38
ENSDART00000105967 Missense 289 1090 10 39
Genomic Location (Zv9):
Chromosome 4 (position 18743703)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19820309
GRCz11 4 19809285
KASP Assay ID:
554-4344.1 (used for ordering genotyping assays)
KASP Sequence:
CTCAGKCAGCGAGATGCTGGAGACTCTCTCAGATGACGATTACKTCAACA[T/C]CGTCTCTGTGAGTATACAGGAGATGAKCGACTTCCGCAAAACTGACTCCC
Long Flanking Sequence:
ATTGATTGATTGATTGATTGATTGATTGATTGATTCATTGATTGATTCATTCATTGATTCATTCATTCATTCATTCATTCATTCATTCATTTTTTCCTTCATCTTGCTAGCCCTCTTAACATAGCCAATCTTATCTATATTTACCGTATAAGGCATCTCTCGAATTATTTATTCATTTCAAGTAAGATGTAATATTTTTGTCAGTTTGTTTTGTCCATATCTATGAATGTTTGTTTTGTTACACAGTTTGTTATCTTTATTATAGTTTCTCATATTAACTTATATAGTCACATATATTATACAGTCACATACTATTATTGAAAACACGAGTTAACAAATCTTTTGCAGCTGTTATACAGTAATGAATGTGTAATAACTATGTAGTGACTGTGCTGTGTTTCTCTGTAGGAGTGGAAGTGTGTCAGGCCTGACGCTGAAGCTCATTCGCACCTCAGTCAGCGAGATGCTGGAGACTCTCTCAGATGACGATTACGTCAACA[T/C]CGTCTCTGTGAGTATACAGGAGATGATCGACTTCCGCAAAACTGACTCCCTGCTGAGCACAATCGAAAGTCTCAAGCGCGGAGCCTCCAAACATCCATAACGTCACACTTAATTTTCTGCGGTTTCACTTCGGCACCGCTGAGGCGCAGGCCAAAAGAATTATTGACATTTCCCATCATCCTTTGCTCCAGACGCCGTGCAATTCATTTATGAAATGCATCGTTTATTTCATTCCGTTCATGAGACCTACTGACAGGAATAAAAAACAACAACAAACTCTGCTTTTAAGTAAGTGAGTGAGCTGTTTTGTATATTTTCAATTAACTTTCGTCCTTCATTGCTTTAATAGTCACAAACGCTCGTATTTTATGGCGCGTTTCCAGCTGTGTGACGTTAGCTTGACATTAATGAAATTAGGCAACAGTGCTTTAAGTGTATTGCTGGCACTGAGCCACCAGACTTACATAGAGGAGCTGCACTAAGCCTGAATCTTAATGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45174
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014440 Nonsense 448 1069 15 38
ENSDART00000105967 Nonsense 448 1090 15 39
Genomic Location (Zv9):
Chromosome 4 (position 18740401)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19817007
GRCz11 4 19805983
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGTGAAAGCAGACAAGAAAGCTAAAAATGTGCAATGGACCAACGTTTA[T/A]GTGGATGCTCTGGTATATGTCAGATATTCTAAATACTAATAGAGATGCTT
Long Flanking Sequence:
ATATATTATAGTTTGTACATTATAAAAATCGTGAACCACATATAAAAGTATGTGTGTAAAATATAATATGAGCAGTCAAACACATTTTCCACTATTTATAATCAACAATATCAATCTTCCACCAGGTTAGAATCTTCACCTTTTCTGTGGGCCAACATAACTATGACAAGGCACCAATACAATACATGGCTTGCCATAACAAAGGTAAAGCATGCTGACATTTATTGAAGTTCCTTTTAAAGTTCTCTTCAAATGGTTGTGTCTACATTTATGAACATGAATTAAGATGTAAGGCATCCTGCAGGTTATTATTATGAGATCCCATCGATTGGAGCCATCAGGATCAACACGCAGGTATATGACGGCATCTTTTAGTGCATAATCGTGACTTCTGTATGAAAATGACTAAGTCTATACCCACAGGAGTACCTGGATGTTTTAGGCAGACCTATGGTGAAAGCAGACAAGAAAGCTAAAAATGTGCAATGGACCAACGTTTA[T/A]GTGGATGCTCTGGTATATGTCAGATATTCTAAATACTAATAGAGATGCTTAATTTGACTGATTTTAAGTATGAAATGGCTGACGGTCATAATTGTGCTGCAGGAACTGGGCCTGGTGGTTACAGGAACTCTTCCAGTGTTCAATAAGACCAGGACCAGTAAAGAAAAGCCTAAGGTACTATTTTGTTCATTGGAATGTTTTAAAATGGATATTTCATCAGCTATGAAAATGTGAGATTGTTATTTTACACTCCCTCAGGCCATCTACTGTAATATGCAACTTTTTTTCTTCACTCAAACATTAAAGAAAATTATTTAGCTGAAACTGTGATACTAGTCAACATCTATCAGCATTTGTTTTTTAAGTAAAGCATAACAATATTCCACATTTTTACACGCGTAACTAATGTGTTTCAAATTTAGGGTTGGACTTTTAGTGCTAGGAACATCCATTCAAACGAACTGAAATGAATCGCTTTATATAATATGTTTGTGCAAAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3472
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014440 Essential Splice Site 554 1069 19 38
ENSDART00000105967 Essential Splice Site 556 1090 19 39
Genomic Location (Zv9):
Chromosome 4 (position 18735747)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19812353
GRCz11 4 19801329
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGACGCTGGACTTCTTGGATGCTGAGATGGAGGATGAAGTCAAAGTGGAT[G/A]TGAGAAYAAAACAAATGTATTAATGTTGACTTGATCTACTAATATTTCTA
Long Flanking Sequence:
AACCTTCAACCCAAGGTACGGCTTTCACTCATGCCATTGCTATATGTTTTAATCCAAAACTGTGTACTGTATAGGATCACGGCTAAACAACCTTCACCACAGCTTATGAAATATTACAGGCCACCCACATGTGTGGAGGTCGTCTGGCCTTCATAATAAATATCATTTGTGCAATCCAAACACGTTCGTTCTGTTTAGCTCTAAGATAAAATGGCACTGAGGGCATTTATTCGAAACACATGATGATTAGTAAATGTTTAGTCAGTGATCCATGGATTAGTGAGCACTTTGTGTGGAACAAAGTAGAAATGTTGAAGAAACGGGCACTCCTTCGTGGAAAAAGTGACTCATTGGTAAATATTTTTGCTCAGAAATATGGTGTGTTGATTTATGGTATTGCTTTGAAAGTTGTTGTTGTTTGTGTGCAGGATCTCAAGTCTCAGGAACCTGTGACGCTGGACTTCTTGGATGCTGAGATGGAGGATGAAGTCAAAGTGGAT[G/A]TGAGAACAAAACAAATGTATTAATGTTGACTTGATCTACTAATATTTCTAAACCCAAATAATTCATTTCCAAACATTAAGGATGTTTTTAGGCTCTATATTTTCAGACTGATCAGACTAGGGTTTGCATAAATTAGCTGAGCATAGCTACAAAAAATACACTGAGGACGTTTCCCGGCTTGAAAAAAAAAACAGCATATTCTGGTAAGGTATGATTTGATGCTTTGAGACCAGCAAAACCAGCATTAGAACCAGCAAGACCAGCATCGAGACCAGCAAAACCCCCATTGAAACCAGCATATCTGCATCAAAACATCCTTACCAGCATATGCTGTTTTTTTTTTTCAGCAAGGTTTTTAGCTTTTAGGGACTATTTGACCTACATCCACTAAGTTCAAGAGATTAAGTTGGATATCTATCTGTCACTATAGCTAATCCTAGTAAGAGTTGAGAACATGCTTACAACATACAAATCTTGCTAGCAACATTGTTAAATGTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26286
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014440 Essential Splice Site 599 1069 21 38
ENSDART00000105967 Essential Splice Site 601 1090 21 39
Genomic Location (Zv9):
Chromosome 4 (position 18732044)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19808650
GRCz11 4 19797626
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGGCTTCAGGACGTACACTTGGTCTCCAGTCACTGACGCAGATTACAG[G/T]TCAGAAAGTTTTAAAATATTTTATTTTATTTTATAAAACAATTGAAAATG
Long Flanking Sequence:
ATTTTACTCAAATGCATAACTATAAATCATAAACAGAGAAAATGTGAATGTTCAAGTAGTTTCTATTTTTAATCTATAGATGGATGCTGGAAGTTAAATGGACTGGACATAAAATGACATTTATTGGTTTGTTATTGGTTTCTAAAAGTTTCTGTTAATAGTTTACAGCAAAAAATATATTGTGTTAGGTTTAAAGAAAGTTGTTATTCTAGTTGTGTTGTTGTTAAATACAGTAGATGACATTTGTCTAAATAGAGCTTGATTGACCTCATTTTCTTTTGACATAAACAATGAATATTTTTTTCTCCTCTTAAATGTTTTTGGGTCGTAGTCCACCAGTTGAGAAACCCTGTGCTACAATACTTGTTATTCAGAAGTAAAAAAGGCTGAATGTAGTAGTTCATTGAACTTCTGAGTGTTGTTTTAATGTCATTGCAGCGTTACATAGACAAGGGCTTCAGGACGTACACTTGGTCTCCAGTCACTGACGCAGATTACAG[G/T]TCAGAAAGTTTTAAAATATTTTATTTTATTTTATAAAACAATTGAAAATGGGCTTGTCCATATTTGACCCAAATTTACAAGCAAATTAGAATTTTTTTTTTATGTTTGTGTTTAAATTTTTTTTCTGTAAATTTTTGTAGCATTGTTGCATGTTTATATTATACGAGTGAGCTTCTTCCTGTGGGTTACAAGTAAACAAAAAAAGTATTTATTTATTAGTCTTTTTATCTTTTATGTTTTGTTTTGTTGAAAATATGGTCTTTTTGTTTTGTTTTTGGTTTGTGGTTTTTTATTGTGAAGGTTTTGTGTTTTTATATTGTGAAGGTGTGTTTGTTTATGTTTTGTTTATTTTTGTAATATATTTCTGTTTTATTTGTAAAAACCTTTTGTCTTTTTTATTTATTATTTTGTTCTGTTTTGTTTTTCTCTTGTTTTGACATGTTTTTTTCATTGTGAAGGTGTGTTTGTTTCTTTTTGTTTTGTTTATTTTTGTAATATAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26285
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014440 Essential Splice Site 848 1069 31 38
ENSDART00000105967 Essential Splice Site 857 1090 32 39
Genomic Location (Zv9):
Chromosome 4 (position 18716470)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19793076
GRCz11 4 19782052
KASP Assay ID:
2259-4853.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGATGGAGGATTCCTTGTCATGGCCAATCAGGACAAATACATTGACCAG[G/T]TGAGTCTCTCCACCTTTTTGTGCAGAGTTTGCGAATGGGTAATCTTTTTA
Long Flanking Sequence:
TATTTTTAAAGAAAGTTTCTGGGTCTTTTCAGTAAAAGCAGTAATATTGTCAAATATTGCTATAATTTATGCATTTTAAGGCATTTTCAACATCATTAATCACATAATCCTTCAGCAATACCTATAATTGCATGGTTTACTTTTTATGTGCATTTTTAAGAATGGTTTAATTATTAGAAATGTCACATTTTCAAATATACATTTTTTATGACATAATGAAAAGCCTTTAGTACTGCACTTACAGTCGCATTAACTTTTAATTATTGATTTTTTTTTTATTATTTGTAAATCCGTTTTATTTCACATTGTTATTTCCTAAGGGTATAGTTTTTTTTTTCAGAATGAAAGGAAATATTTATATTATTAATAAAAAATTCCCCAAACAGTAGTCTATATTACTATAAAACTGTATTAAACTTTCTCTCTAGTATCTGGACTGTGTTCTTCTAGACGATGGAGGATTCCTTGTCATGGCCAATCAGGACAAATACATTGACCAG[G/T]TGAGTCTCTCCACCTTTTTGTGCAGAGTTTGCGAATGGGTAATCTTTTTAACTATTCTTCTGCAGATGAAGTAGTTGGTTTCTGTCTATGGGTGAAGATTGTTTTTTTTTTTCTATAATTTATTTTTGGGCATACTTATATAGTTCGAGAGAAAAATTGTGTTGTGAAAAAAGTGATGTACCTATGCTTTTGGGGCTTTTAGCGTCTCAATTGAGAATCGTGCTTGCATAGCATAAGCTGGTAGATTCATTGCCAAAATGTATAGAAATATAAGAAATTATTGAAGTGTTATGGCTGGGTCCAAAACCGCATACTTCCATACTGTATAGTATGCTAAAATTTGTATGCCGGCTGAGTTTTATGTCCGAATTCAAAGAATTTGAAAATCAGTATGTGAGAAGTACCCAGATGACCTACTACTTCCTGATTCAGGTAGGTCACGTGATCATGTTAAAATGGCAGATGTAGTACATTCGAATTATATTCATACTGCTCACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8955
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014440 Nonsense 876 1069 32 38
ENSDART00000105967 Nonsense 885 1090 33 39
Genomic Location (Zv9):
Chromosome 4 (position 18712362)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19788968
GRCz11 4 19777944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAATGAGAAATCTGATGAACGTGTCCCTGTTYTCMGTCAACATAACCTA[C/A]GACTACCAGGCYCTTTGCGAACCCACCAGAGAATCTAAAGCTGCCGCTGG
Long Flanking Sequence:
CAAACCATCGTTATGCAATAACTTACCTAATTACTCTTACCTACTTAACCTAATTAACCTAGTTAAGTCTTTAAATGTCACTTTAAGCTGTAAAAAAAGTGTCTTGAAAAATATCTAGTAAACTATTATTTACTGTCATCATGGCAAAGATAAAATAAATCAGTTATTAGGGGTGAGTTTTTAAAACTATTATGTTTAGAAATGTGTTGAAAAAATCTCTCCCCGTTAAACAGAAATTGTGGAAAAATATTGGCAAATATTTAGGGGGGCTAATAATTCTGACTTCAACTGTATTTAAAATAAATTTTTCCTAAAATAGTCACCTTGGTCAGCTCTTAATTATTAATTAGAAAAATCCCTGTACACAACAAGCATTTTTACACTAGATGTGTGTTTGTGTGTCTTATGTGTTTGCAGATTGGAGAGTTTTTCGGCATGATTGACCCCAGCCTAATGAGAAATCTGATGAACGTGTCCCTGTTTTCAGTCAACATAACCTA[C/A]GACTACCAGGCCCTTTGCGAACCCACCAGAGAATCTAAAGCTGCCGCTGGTCTCAGATCAGTCTATGTGGTGAGTGCAAGTCCATTTGTAAACCTAAACAAATGTGTATAGCTTCAATCTAGTAGTGGCTTGCATGATGTTTTAAAGGAACTCCCATTTTTAAATCCATTCAGCTGATCTCTGGGTCTGGCAGAAGAACTTTTAGCTTAGCTTAGCATAGATTGTTGAATCGTATTAGACCATTAGCATCTCGCTCAAAAATGATTAAATATTTAAAAAATGAAAAGTTGCTAATTTCTTGTCCAATACAGTATGACCAGGAACTATAGGCTACCCGTATCCTGGTGTATTAATCAAAGAACTTTGCTGATGTACCATGGCTGCAGCAGGAGCAATGATAATATGCAGCACCTTAAAATTGGCTAACTTTTGTAAATATAACTAATGTGTCTACCTGCTTACACAAAAGTGTGCCTTGCAACCAATAAGACATTTGGAAT
Associated Phenotype:
Not determined