Busch Lab

ZMP

si:dkey-4c15.2

Ensembl ID:
ENSDARG00000014775
ZFIN IDs:
ZDB-GENE-050320-64, ZDB-GENE-050420-77
Description:
hypothetical protein LOC568943 [Source:RefSeq peptide;Acc:NP_001025399]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6687 Nonsense Mutation detected in F1 DNA Not yet available
sa31065 Nonsense Mutation detected in F1 DNA Not yet available
sa15555 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6687
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106415 Nonsense 66 497 1 2
ENSDART00000141776 Nonsense 85 192 3 4
Genomic Location (Zv9):
Chromosome 22 (position 1659944)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2401034
GRCz11 22 2417300
KASP Assay ID:
554-4140.1 (used for ordering genotyping assays)
KASP Sequence:
AGAGTTTCMGGCATAACCGCGATCTCGTTCGTCACACGATGATCCACACT[G/T]GAGAGAAACCKTACCAGTGTTCGCACTGCGACAAGAGATTCAATGATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31065
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106415 Nonsense 244 497 2 2
ENSDART00000141776 None None 192 None 4
Genomic Location (Zv9):
Chromosome 22 (position 1662920)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2404010
GRCz11 22 2420276
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAAAGCACATGAGAAGATCCACAGTGGCGTGAGAGAGTTTGCGTGCGAT[A/T]AGTGCGACAAGACTTTTCTAAGAGCTGGAAACTTGAAACGACACCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15555
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106415 Nonsense 266 497 2 2
ENSDART00000141776 None None 192 None 4
Genomic Location (Zv9):
Chromosome 22 (position 1662986)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2404076
GRCz11 22 2420342
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTAAGAGCTGGAAACTTGAARCGACACCAGARGACTCACGCTAAAGAT[A/T]AACCTGGTATTCAGTCGAGCAGCAGCMTGAGATTCGAGCAGCCACAAATC
Associated Phenotype:
Not determined