Busch Lab

ZMP

zgc:101042

Ensembl ID:
ENSDARG00000014761
ZFIN ID:
ZDB-GENE-040801-105
Description:
Major facilitator superfamily domain-containing protein 6-like [Source:UniProtKB/Swiss-Prot;Acc:Q6DB
Human Orthologue:
MFSD6L
Human Description:
major facilitator superfamily domain containing 6-like [Source:HGNC Symbol;Acc:26656]
Mouse Orthologue:
Mfsd6l
Mouse Description:
major facilitator superfamily domain containing 6-like Gene [Source:MGI Symbol;Acc:MGI:2384904]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20013 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8118
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007119 Nonsense 172 542 3 3
ENSDART00000007119 Nonsense 172 542 3 3
Genomic Location (Zv9):
Chromosome 3 (position 25952673)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25720858
GRCz11 3 25851406
KASP Assay ID:
2259-3459.1 (used for ordering genotyping assays)
KASP Sequence:
AACTCTGGAGRATAACACACTTGTAAACCACAGCAGGTCAGCAAGAGGCT[T/A]GAGATCTTTAAAGAAGGAAGAAGAACCTCACAGTGAGTTCCTGGGGAGCC
Long Flanking Sequence:
GATGCAGAAGAGCAAGCAGTGGAACGTGAAGGGAGCCGTGCGGCTGGCAAGTGTCTTTCACTTCCTCCATTCATGTGGCTCCGGGTGCCTCCTTCCCTTCCTGACCCTCTACTTCCGGCATCTGGGTCTCAGCGCTGCCATGATTGGAATCATCATGGCGTCCAAGCACTTGCTGGCCTTGTTGTGGCGCCCGTTCTCCAGTGTTCTTGCCAGGCAGTACGACAAACGGCGTACGGTCATAGTGGGCTCCTTGCTCAGCTCGGCACTGGTGGTTTTGCCTCTTCTGTTGTTCCCATCTGCAGGGATCCTGGTCGAAAGTGGACGGTGTAACACCAGTCAACCTGATGCTGATCCTACCTTACCACTCGCCGTCATAGAGCAAATGACAGTCCCAGTAGGCTCAAATGCAACTGTGTACTCAGTAAACCAAACATCTGTAAGCACCAATCAAACTCTGGAGGATAACACACTTGTAAACCACAGCAGGTCAGCAAGAGGCT[T/A]GAGATCTTTAAAGAAGGAAGAAGAACCTCACAGTGAGTTCCTGGGGAGCCTGAAAGTTATGGATGCCCAGCATCAGATGTTCTTTCTGGTGCTCCTTGTGACTGCTTTGTGGGAGTTTGTGGCCGTCCCGCTGGAATGGACGGCGGATGACGGACTCTATGAATACTTGGATTTTGTAGACGCCACTGACCGGCATAGTGGTGTGAAGGTCTGGAAGCATGTTGGGGCTGCTTTTGGCAGCTGTCTTGTAGGTGTTCTTGTAACCAACCTGTTCTGCCGGATTGGAAATTCGGTGGAGTTTTATTCATACACAGTACTTATGATCCTAACTGTACCAGCATCTGCCCTGCTACCAATCTATCTCCGAAAGCGTGAGCGCCCCACTAGTGGTGGCTTTAAGGCACTGCAGTTGGTGCATGGGAATCCACAAGCGATACTTTGTGCAGTCACTGTTATTTTGACAGGCATGGTGACCTCTGCTGTGTCAGATTTTCTCTTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18754
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007119 Nonsense 172 542 3 3
ENSDART00000007119 Nonsense 172 542 3 3
Genomic Location (Zv9):
Chromosome 3 (position 25952673)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25720858
GRCz11 3 25851406
KASP Assay ID:
2259-3459.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTCTGGAGGATAACACACTTGTAAACCACAGCAGGTCAGCAAGAGGCT[T/A]GAGATCTTTAAAGAAGGAAGAAGAACCTCACAGTGAGTTCCTGGGGAGCC
Long Flanking Sequence:
GATGCAGAAGAGCAAGCAGTGGAACGTGAAGGGAGCCGTGCGGCTGGCAAGTGTCTTTCACTTCCTCCATTCATGTGGCTCCGGGTGCCTCCTTCCCTTCCTGACCCTCTACTTCCGGCATCTGGGTCTCAGCGCTGCCATGATTGGAATCATCATGGCGTCCAAGCACTTGCTGGCCTTGTTGTGGCGCCCGTTCTCCAGTGTTCTTGCCAGGCAGTACGACAAACGGCGTACGGTCATAGTGGGCTCCTTGCTCAGCTCGGCACTGGTGGTTTTGCCTCTTCTGTTGTTCCCATCTGCAGGGATCCTGGTCGAAAGTGGACGGTGTAACACCAGTCAACCTGATGCTGATCCTACCTTACCACTCGCCGTCATAGAGCAAATGACAGTCCCAGTAGGCTCAAATGCAACTGTGTACTCAGTAAACCAAACATCTGTAAGCACCAATCAAACTCTGGAGGATAACACACTTGTAAACCACAGCAGGTCAGCAAGAGGCT[T/A]GAGATCTTTAAAGAAGGAAGAAGAACCTCACAGTGAGTTCCTGGGGAGCCTGAAAGTTATGGATGCCCAGCATCAGATGTTCTTTCTGGTGCTCCTTGTGACTGCTTTGTGGGAGTTTGTGGCCGTCCCGCTGGAATGGACGGCGGATGACGGACTCTATGAATACTTGGATTTTGTAGACGCCACTGACCGGCATAGTGGTGTGAAGGTCTGGAAGCATGTTGGGGCTGCTTTTGGCAGCTGTCTTGTAGGTGTTCTTGTAACCAACCTGTTCTGCCGGATTGGAAATTCGGTGGAGTTTTATTCATACACAGTACTTATGATCCTAACTGTACCAGCATCTGCCCTGCTACCAATCTATCTCCGAAAGCGTGAGCGCCCCACTAGTGGTGGCTTTAAGGCACTGCAGTTGGTGCATGGGAATCCACAAGCGATACTTTGTGCAGTCACTGTTATTTTGACAGGCATGGTGACCTCTGCTGTGTCAGATTTTCTCTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20013
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007119 Nonsense 292 542 3 3
Genomic Location (Zv9):
Chromosome 3 (position 25953034)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25721219
GRCz11 3 25851767
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGTACTTATGATCCTAACTGTACCAGCATCTGCCCTGCTACCAATCTA[T/G]CTCCGAAAGCGTGAGCGCCCCACTAGTGGTGGCTTTAAGGCACTGCAGTT
Long Flanking Sequence:
CCACTCGCCGTCATAGAGCAAATGACAGTCCCAGTAGGCTCAAATGCAACTGTGTACTCAGTAAACCAAACATCTGTAAGCACCAATCAAACTCTGGAGGATAACACACTTGTAAACCACAGCAGGTCAGCAAGAGGCTTGAGATCTTTAAAGAAGGAAGAAGAACCTCACAGTGAGTTCCTGGGGAGCCTGAAAGTTATGGATGCCCAGCATCAGATGTTCTTTCTGGTGCTCCTTGTGACTGCTTTGTGGGAGTTTGTGGCCGTCCCGCTGGAATGGACGGCGGATGACGGACTCTATGAATACTTGGATTTTGTAGACGCCACTGACCGGCATAGTGGTGTGAAGGTCTGGAAGCATGTTGGGGCTGCTTTTGGCAGCTGTCTTGTAGGTGTTCTTGTAACCAACCTGTTCTGCCGGATTGGAAATTCGGTGGAGTTTTATTCATACACAGTACTTATGATCCTAACTGTACCAGCATCTGCCCTGCTACCAATCTA[T/G]CTCCGAAAGCGTGAGCGCCCCACTAGTGGTGGCTTTAAGGCACTGCAGTTGGTGCATGGGAATCCACAAGCGATACTTTGTGCAGTCACTGTTATTTTGACAGGCATGGTGACCTCTGCTGTGTCAGATTTTCTCTTATGGCTGATGCAGGACTGCGGTGCCATGGAAATCCACATGGGAATATGTTTAGCATTGGCGCACTTAAGCCACACTGGCTTTTCACCGATTGCTGGGCCTCTATCCCGATTTCTAAAGTACCACGGTTGGATGTTAGTATTGGCTGTTGTTGGTTTAGCCATGCAGTGCCTTTATTATTCCTTCTTATGGAGCCCTTGGGCTGTAATGCCAGCTCAACTGTTGGCAGGCTTCAGCACCGGCGCCCTCTGGTGGTCTGTAACATCACAAAGTGAAGATATTGCCACTCCAGGCACCGAAAAGACAATTTTAAGGCTTTTTGAGGCCTTTTCTTTAGACATGGGAGCTGCATTGGGCAGTCTGAT
Associated Phenotype:
Not determined