Busch Lab

ZMP

rbfox1

Ensembl ID:
ENSDARG00000014746
ZFIN ID:
ZDB-GENE-040927-11
Description:
Fox-1 homolog A [Source:UniProtKB/Swiss-Prot;Acc:Q642J5]
Human Orthologue:
RBFOX1
Human Description:
RNA binding protein, fox-1 homolog (C. elegans) 1 [Source:HGNC Symbol;Acc:18222]
Mouse Orthologue:
Rbfox1
Mouse Description:
RNA binding protein, fox-1 homolog (C. elegans) 1 Gene [Source:MGI Symbol;Acc:MGI:1926224]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa15940 Essential Splice Site Available for shipment Available now
sa26072 Nonsense Mutation detected in F1 DNA Not yet available
sa15281 Essential Splice Site Available for shipment Available now
sa38393 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15940
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122037 Essential Splice Site 12 373 2 12

The following transcripts of ENSDARG00000014746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 28219448)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 27937487
GRCz11 3 28068329
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAAACTAYCCAGGCAGTCATTTGACCATTTTTGAAATGTTGTTTTTTTNC[A/T]GGGTAAWCAAGACGCCCCAGCACCCCCAGAAACCATGGCCCAGCCTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26072
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122037 Nonsense 149 373 4 12

The following transcripts of ENSDARG00000014746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 28196826)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 27914865
GRCz11 3 28045707
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATCTGTCTTCTGTTCTCTTTCCAGCAATTTGGTAAAATCTTAGATGTT[G/T]AAATCATATTTAATGAACGAGGATCAAAGGTACGTTTTGTGACTTTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15281
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122037 Essential Splice Site 210 373 6 12

The following transcripts of ENSDARG00000014746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 28193032)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 27911071
GRCz11 3 28041913
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGCACGGGTAATGACGAATAAAAAGACAGTCAACCCATATGCAAATGG[T/A]AAGAACAAGCTCCCTTGATGTTGTCGAATGCATAMGAGTATAGATTGAGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2130
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122037 Essential Splice Site 210 373 7 12

The following transcripts of ENSDARG00000014746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 28190709)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 27908748
GRCz11 3 28039590
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTASAGTTTTAGTTTGCTAATATCAGATCTCTTGCTCTCTGTGTTTGTCT[A/G]GGCTGGAAGTTGAATCCAGTCGTGGGTGCAGTCTACAGCCCAGAATTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38393
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122037 Nonsense 211 373 7 12

The following transcripts of ENSDARG00000014746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 28190703)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 27908742
GRCz11 3 28039584
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTAGTTTGCTAATATCAGATCTCTTGCTCTCTGTGTTTGTCTAGGCTG[G/A]AAGTTGAATCCAGTCGTGGGTGCAGTCTACAGCCCAGAATTCTATGCAGG
Associated Phenotype:
Not determined