Busch Lab

ZMP

acox1

Ensembl ID:
ENSDARG00000014727
ZFIN ID:
ZDB-GENE-041010-219
Description:
peroxisomal acyl-coenzyme A oxidase 1 [Source:RefSeq peptide;Acc:NP_001005933]
Human Orthologue:
ACOX1
Human Description:
acyl-CoA oxidase 1, palmitoyl [Source:HGNC Symbol;Acc:119]
Mouse Orthologue:
Acox1
Mouse Description:
acyl-Coenzyme A oxidase 1, palmitoyl Gene [Source:MGI Symbol;Acc:MGI:1330812]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa5364 Nonsense F2 line generated Not yet available
sa16860 Nonsense Available for shipment Available now
sa13596 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5364
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049226 Nonsense 42 660 2 14
ENSDART00000067560 Nonsense 42 660 2 14

The following transcripts of ENSDARG00000014727 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 21709589)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 18025363
GRCz11 6 23123282
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATCTGTTTTTTTGTTTTGTTTGNTTTTTTTCTAGAGTCTCTGGTTATT[G/T]GAGATCCAGATTTCCAACATGAAGACCTAAACTTTCTCTCTCGAAGTGAG
Long Flanking Sequence:
AATAGTCATGAATCCTGATATTAGCCGTGAACGTGAAAATGCGTCTTTTAACCTGGAGATTCTTACAAACGTGCTGGATGGTGGAGCGGAAAAGACAAATAGAAGGAGAGAAATAGGTCAGCTGCAAAAGTGTTTTAACGTTGCTATTTAATAACTTAAATAACCTATTTGATTGTAAACGTATTTTCCGGTCATTTGTGTGCATAGGTTAACCTATTGACATGATTAAGTTCAGGTATATGTATGTTAATTTAATGTATTTCTTTAGTAATATAATGTACCCTTGCAATTTTACAGTTTGTGGAGCTCTTAAAAATTAAACTGATAATATAAATATTTACCTTGAAGTCAGAGCGCCTTTTATATATATTGAATTAGTTGGCCCATTTCTGTACAAGATCAAGATATCAAGCTAAAAAGTAAAAAAAAAAAAAAAAAAAAAAACACCCATCATCTGTTTTTTTGTTTTGTTTGTTTTTTTTCTAGAGTCTCTGGTTATT[G/T]GAGATCCAGATTTCCAACATGAAGACCTAAACTTTCTCTCTCGAAGTGAGCGATATGATGCAGCAGTGCGGAAGAGTGCACAGATGATTCTGAAACTTAGGGAATATGGTATCTCTGATCCAGAAGAGATCTACTCCTACAAGACGTAAGCAAAATTGTCATGGTTAAAGAAACTTATAGTTATAGAAGTTATAGAATATGGATAGTTGAGAGAAGTTTAGAGGACAGAAAACACTGAGATAAGAATTAACTGAAAAAAATAAACATACACTACAGTTCTTTTTTTGAGGTCTTTGTATTATATTTAAAAAAAAGTCAAATATAAAATAAATATAATGCAAATATATGTTTTTTTTTAATAGCAAATATCTTGGTGTTTGTGTTACCTTTGTCCCAACATCTCTACAATTAAATTACACCTCATGTATTGGTTAATGCAATGAATCACCAAAACAACACAATTTTTATGAAATTTTCAAAATCAGTGTTGTAAAATATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16860
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049226 Nonsense 136 660 3 14
ENSDART00000067560 None None 660 None 14

The following transcripts of ENSDARG00000014727 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 21710594)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 18026368
GRCz11 6 23124287
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCAAAAAATGGATCCCMTTAGCTGAGTCATTCCAWATGTTAGGCACCTA[T/A]GCTCAGACAGAGCTGGGGCACGGTCAGTTCTTCTCTCCTGAACAATTATT
Long Flanking Sequence:
GAGTTGCATATGAATGTTAGCTACAATTTGCAAGCAAAAGTTACAGTGTTTGCAGAGACAGCCAGGGCAAAGGTCTCAGATTAAAAGTGTGTCAAAGGGAAGTAAAATGTTTATCATCTCCACTCCTATTCTCAGATTAAATTAGCTGAAACAAATAAAACTGATACATTTTTGGTGATTCAGACATTCCTAAAAACTAAACTTTAAATACACATTTAGCATAATGAAAAGTATTAGGAGTACAGCTAATTGGGATTAAACATCTGGTTTCTATTAACTTAAAAAGACTTTTTATAAAACCCTCTAAAGTACAATGTGTATCTTCATGTATGTTTACTACATTTGTCTGTTCCATTCTGCAGTGTTGTGAGGGGTGTATTTCAAGAGCCCCTAGGTGTCCATAATGTCATGTTCATACCCACCTTAAAAAGCCAGTGTACTGCTGAACAACGCAAAAAATGGATCCCCTTAGCTGAGTCATTCCATATGTTAGGCACCTA[T/A]GCTCAGACAGAGCTGGGGCACGGTCAGTTCTTCTCTCCTGAACAATTATTTGAAATGTACTTTTAAATATTAGTAATAAGCAAAAAAGTATTGTCCTTTTTGGTTCAGAAATATACATTTGTATATTAAGGTGTCACTCTTGTAGGTGTTGACAGCTCAGTATGGTCATAGTCTCAGATTGATTTAGGGGTCTCTGCATTCAAGGTGATTCTCCATTTAATTCTGTATACATTAGAACACTTTTTAAAACCTGACCTTATCTGCATTCAAACATTAAATAGCTTTAGGTCTTTAACTGCTTCTTGATTATCTTAATAACTTGTGGTTTTGCAGTTTTGTGTTTGTCTTTTCATGAAGTCTTTAATTTTCCAGTTATCATTGATTGTGTTTTGTATTGTAAATGGAATCTACACATTTTCAAAACCCTAATAAGTGGAAATGTAGGACAGTGGGTTTGAAGGAAAGAAGCCGAAGCAGTAGGCACTGAGAGAATAATGGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26732
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049226 Essential Splice Site 315 660 8 14
ENSDART00000067560 Essential Splice Site 315 660 8 14

The following transcripts of ENSDARG00000014727 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 21714946)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 18030720
GRCz11 6 23128639
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATATAAATTTGTCATTTTTTTATTTTGTTCCTTTTCATATTTTTTTTCT[A/G]GTGAACCTGAGCCACAGATCTTGGACTATCAAACCCAGCAGTATAAACTA
Long Flanking Sequence:
TTAATGGCACCACTGCCTATTAAGAATCCTGTAATCTGTGTCCACTAGAAAAATGGCATATAAAATGGCTTAATGTGCTATGTGTATATGTCATGTGGGTAATAACTGTACTTTATGTGGCGTGTGTGCTTTTATAGGTTGAACCGGATGGTACATATGTGAAGCCTCCTAGTGATAAACTCACATATGGCACCATGGTGTTTATTCGCTCCATGATAGTGGGAGAGTCAGCACGAGCTCTCTCCAAATCCTGCACTATTGCCATTCGCTACAGTGCAGTCCGACATCAGTCTGAACTACGCCCAGGGTAGGACTCTCTTTTCTCTCTCATGTCTTTCCTCCTTGCACTCTCATATGCACTTTTTACTTATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAAATTTGTCATTTTTTTATTTTGTTCCTTTTCATATTTTTTTTCT[A/G]GTGAACCTGAGCCACAGATCTTGGACTATCAAACCCAGCAGTATAAACTATTTCCTCTTCTGGCTACTGCATATGCCTTTCACTTTGTAGGGCAGTACATGAATAAAACATACCATCGCATCTCAGGAGACATCAGTCTGGGTGACTTCAGTGAGCTTCCAGAGGTATGCAGAAATATGTTGTCAAAATATTTTTTTTCTCTATTCAATATACAGTTGAAGTCAGAATAATTAGCCTCCCTGTTTATTTGTTTCCCAATTTCTCTTTAACGGAGAGATTTTTTTCAACACATTTCTAAACCTGATAGTTGCAATTCCTCATCTCTAATAACTGATTTATTTTAACTTTGCCATGATGACAGCAAGTAAAATTTGACTAGATCTTTTTCAAGACACTGCAATATATTTTATATTTTACATTTAACGTTGTCCTGTTTTTTTTTTTTTTTTGGAGGCGGGGGGGGATGGGATGGGGGGTATGCTGATTTATTTTGCACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13596
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049226 Nonsense 589 660 13 14
ENSDART00000067560 Nonsense 589 660 13 14

The following transcripts of ENSDARG00000014727 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 21723646)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 18039420
GRCz11 6 23137339
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTTTCTCAGGCTGGTCTGCTAAGTGTTTCTCAGCTGGATCAGATTTCA[C/T]AGAGGCTGAAGGGTCTCCTCTTAGAGATAAGGCCCAATGCAGTGGCTCTC
Long Flanking Sequence:
TACAGGCCCATTGCCATTATGTGGTTGTGAAGCTCTTTGCTGCTAAACTGAGTGAGATTGGAGATAAGGCTGTCCACTCAGTACTCAGCACTTTGGCTCTGCTTTATGCCCTTCATGGAGTTGCACAGAATTCTGGGGACTTTTTAAAGGTAATACAATACAATACAATACAATACCAAATACAATACAGTACGACAGTTCATAAATGTTGCTTAACTCAGACAGTAACCACAACTCATGAATGAAATGACTGAGTTTGTTTTCATGAAATTTATTTGCTGTTAAATGTATAAACATTTGTTTACTCAAAATTTGATTTGTGTCTAATGATATTTTATAAGAGTCATTGGTGTTAAGGGACATCCTGCTGATTTCTGTACATTATTTAAAGACCACTTTCTTAGACCATCATTTAGCAGTGTTTGATAGAAACAGACCTTACAGTTTGTCTTCTTTCTCAGGCTGGTCTGCTAAGTGTTTCTCAGCTGGATCAGATTTCA[C/T]AGAGGCTGAAGGGTCTCCTCTTAGAGATAAGGCCCAATGCAGTGGCTCTCGTTGATGCTTTTGACTACCGTGATGAGATGCTTAATTCTTCTCTGGGACGATATGATGGCAACGTCTATGAGCACATGTTTGAGTGGGCCAAGAAGTCACCTCTGAACCATACTGAGGTGTGTAAATAATAAATTTGCTGTGTGTAAAATTGTAGTCTTGTTATGTTAAATAACCGCTATGGGCTAAATTGTGTTCTCTCTTAAAATATAATTGAATATAAAACACAATAAGTTCAATCTAAAATGGTCTTTTTTTAATGTATTTTTTCTTTTAGGTCCATGAGTCCCACAACAAGTATTTGAAGCCACTACGATCCAAATTGTAACTAGTGCAAGAAAGGGGAAGAAAGGGAAAAGTCTGTCTATTAAAAAAAAATGTTAGAGAAGAAAATAATGTTTGCTTAAATTCTAAATGGATGAGGTTGCATTCTCCATTCTAATAATTTATAA
Associated Phenotype:
Not determined