Busch Lab

ZMP

BCKDHB (2 of 2)

Ensembl ID:
ENSDARG00000014676
Description:
branched chain keto acid dehydrogenase E1, beta polypeptide [Source:HGNC Symbol;Acc:987]
Human Orthologue:
BCKDHB
Human Description:
branched chain keto acid dehydrogenase E1, beta polypeptide [Source:HGNC Symbol;Acc:987]
Mouse Orthologue:
Bckdhb
Mouse Description:
branched chain ketoacid dehydrogenase E1, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:88137]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa22742 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22742
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082071 Nonsense 340 374 8 8
Genomic Location (Zv9):
Chromosome 16 (position 6313200)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5179584
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGACAAAGAGACCGTCTGCAAGGTACCGTCTAAACAATTCTTCATCCAG[C/T]GAGAGTTTATCCCTGTGATCTTCTGTCTTGAATTACAAAGGTGTATTAGG
Associated Phenotype:
Not determined