Busch Lab

ZMP

efna3a

Ensembl ID:
ENSDARG00000014675
ZFIN ID:
ZDB-GENE-060503-186
Description:
Novel protein similar to ephrin A3 (Efna3) [Source:UniProtKB/TrEMBL;Acc:Q1LWM6]
Human Orthologues:
EFNA3, RP11-540D14.8
Human Descriptions:
cDNA FLJ57652, highly similar to Ephrin-A3 [Source:UniProtKB/TrEMBL;Acc:B4DXG7]
ephrin-A3 [Source:HGNC Symbol;Acc:3223]
Mouse Orthologue:
Efna3
Mouse Description:
ephrin A3 Gene [Source:MGI Symbol;Acc:MGI:106644]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa18620 Nonsense Available for shipment Available now
sa39230 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36781 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18620
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027274 Nonsense 119 220 2 5
ENSDART00000147218 Nonsense 83 180 1 4
Genomic Location (Zv9):
Chromosome 19 (position 8938005)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8396544
GRCz11 19 8315469
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCACACGCCCCCCACGCACCCATTAAATTCTCTGAGAAATTCCAACGTTA[C/A]AGCGCCTTYTCACTAGGCTATGAGTTCAACGTRGGACATGAGTACTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39230
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027274 Essential Splice Site 138 220 2 5
ENSDART00000147218 Essential Splice Site 102 180 1 4
Genomic Location (Zv9):
Chromosome 19 (position 8938062)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8396601
GRCz11 19 8315526
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTCACTAGGCTATGAGTTCAACGTGGGACATGAGTACTATTATATATG[T/A]GAGTATTCAGTTCTTGTGTAAGATTTCAACTAAAAGAAGATATGCTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36781
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027274 Nonsense 187 220 5 5
ENSDART00000147218 Nonsense 147 180 4 4
Genomic Location (Zv9):
Chromosome 19 (position 8958480)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8417019
GRCz11 19 8335944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTTTCTTTGCTTTTTTTCTTCCTCTTGTCTCAGACGAGTTTAACCCT[G/T]AGATCCCCAAACTGGAGAAGAGTGTAAGCGGCAGCAGTCCGTCCGGAGAC
Associated Phenotype:
Not determined