Busch Lab

ZMP

si:dkey-42d18.3

Ensembl ID:
ENSDARG00000014651
ZFIN ID:
ZDB-GENE-081104-411
Description:
Novel protein similar to vertebrate supervillin (SVIL) [Source:UniProtKB/TrEMBL;Acc:B8JKW2]
Human Orthologue:
SVIL
Human Description:
supervillin [Source:HGNC Symbol;Acc:11480]
Mouse Orthologue:
Svil
Mouse Description:
supervillin Gene [Source:MGI Symbol;Acc:MGI:2147319]

Alleles

There are 20 alleles of this gene:

Allele Name Consequence Status Availability
sa10598 Nonsense Available for shipment Available now
sa14792 Nonsense Available for shipment Available now
sa19885 Essential Splice Site Available for shipment Available now
sa6021 Nonsense Mutation detected in F1 DNA Not yet available
sa19884 Nonsense Mutation detected in F1 DNA Not yet available
sa14317 Essential Splice Site Available for shipment Available now
sa13615 Essential Splice Site Available for shipment Available now
sa11474 Nonsense Available for shipment Available now
sa39938 Nonsense Mutation detected in F1 DNA Not yet available
sa25123 Nonsense Mutation detected in F1 DNA Not yet available
sa39937 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33029 Nonsense Mutation detected in F1 DNA Not yet available
sa25122 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33028 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8098
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 25 2195 1 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49391563)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49094969
GRCz11 2 48829199
KASP Assay ID:
2259-2680.1 (used for ordering genotyping assays)
KASP Sequence:
GGTTGGAGGGAATYGAGACGGATGTTCCAGCTGCTCTTAATACAAGCATG[C/T]AACACACRGCCGGCCTGGTGACCAATCGGCTAYTGGAGGARGATACACCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8097
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 208 2195 3 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49389234)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49092640
GRCz11 2 48826870
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGAGAGAGAGNNGGCAATGAACTTGGAAAACTATAGACGGGCCCCTGAC[C/T]RAAGTTCRAAGYCACACCCACAGGAAACTCCCATGGAAACATCAGCAGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25919
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 272 2195 3 48
ENSDART00000134711 Nonsense 11 179 1 6
Genomic Location (Zv9):
Chromosome 2 (position 49389042)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49092448
GRCz11 2 48826678
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCTGGAGATCTGTTCATCGAGCAGCAAGCTCAAAATATTCTCAACAGA[C/T]AGGGGTAAGTATGTGTCATGTTTGCTATTGAGCAGCTATTAGCAATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10598
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 300 2195 6 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49386475)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49089881
GRCz11 2 48824111
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAAGTGTTAATTCCTCTCTTTCCTCCATTAATGAAGAATAAGAGTTAGA[G/T]AGAGACAGACAAGGGAGGACATATCAGGAAGAGRTTCTGATTCAGGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14792
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 372 2195 6 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49386259)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49089665
GRCz11 2 48823895
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
STCAAGGWATGGATGCCCGTCAACAAAGGGCGCATAGTGCAGAGCGGCCA[C/T]GATTCCAGCGCACTCACAGTATGGATTCACCTGCCTTTCAACACACACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19885
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Essential Splice Site 460 2195 8 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49385291)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49088697
GRCz11 2 48822927
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGTTGGAACTGGAATTACTCGGATGGAGGAAGGTGGAATGATATCAGG[T/C]GAAATGGTAATTGGTATTCTAAAAGACAGAGGATGTGATGATCGAAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6021
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 464 2195 9 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49385065)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49088471
GRCz11 2 48822701
KASP Assay ID:
554-3966.1 (used for ordering genotyping assays)
KASP Sequence:
GGGATGAGGAGAGCTCTGATTGGAATACTAACCGGTTAGGAGAGATAGAA[C/T]AAGGAAGTGCGAAGAAGGTTAATGAATTCAAAGAAAGAGAATGGGAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19884
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 591 2195 10 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49384316)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49087722
GRCz11 2 48821952
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAGACATTCCTACCTGGAGAATGCTTCTGGACGCAGACCTGAGCTGTA[T/A]GTGGACTGGCATGCCGGCATGCTAAAGCAAGCTTCTGTCATTGACTATTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1403
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Essential Splice Site 641 2195 11 48
ENSDART00000134711 Essential Splice Site 69 179 2 6
Genomic Location (Zv9):
Chromosome 2 (position 49383549)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49086955
GRCz11 2 48821185
KASP Assay ID:
554-1324.1 (used for ordering genotyping assays)
KASP Sequence:
GGTTTAGAACCCAGCCAATTACATCAGCCGAAAGAATGGAGTCTGATAGG[T/C]ACAAAAAACTGACACTACCAATTTGTTATCTGTAGAGGTAAATTGTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14317
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Essential Splice Site 836 2195 17 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49364885)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49067881
GRCz11 2 48802021
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAACACCCGCTTTCAGACCCAGCCAATCACTCAGGACGAGGTYGATCAGG[T/C]AGGGCCTCCCTCTTTTTYTCCATCTGAACAAGTTCACAAATATGGAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13615
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Essential Splice Site 926 2195 18 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49357967)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49060963
GRCz11 2 48795103
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCGCCACACAGCAAGGGCGGGGCTGCATCAATTCCAGCCAATAAWGAAA[G/A]TGGGCAGAGGGGAAGAGCGGGGTATTTAGGCAGAGAGGAGAGAGAGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11474
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 1000 2195 22 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49352917)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49055913
GRCz11 2 48790053
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATCTACACCCGGCCTCAAACGCAACCTTACAGCCCACCGACACCATCA[C/T]AAACWCTCCACCCGGACRTCCATCCAGMGTATCACGATCTTCAACGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39938
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 1048 2195 22 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49352773)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49055769
GRCz11 2 48789909
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCGCCTCAATCACACGCATACATTTCTCCTCCGCCCAAAATACCTCCT[C/T]AAACCCAGCCCAAACCCCAGTGCTTCATCCCGCCTCAGCCTCAAGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25123
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 1147 2195 26 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49340026)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49043022
GRCz11 2 48777162
KASP Assay ID:
554-7487.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGTGTGATCTATAACTGTAAAATCTGTGTTTGCATGATCAGAAACTT[G/T]AAGAGGGTGAGGGTCAGATGTCCATTGAAGAGAGGAAGCAGATGATCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39937
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Essential Splice Site 1225 2195 28 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49337353)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49040349
GRCz11 2 48774489
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGCAATGTTGTTGCACCATGATAACTGGGGCAAAACCTGATGTGCTGCA[G/T]AAATCGAGGCCAGGGCAGAAATGGAGTCTGATAAAAAGCTGGAAAAGCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2054
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 1309 2195 29 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49336910)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49039906
GRCz11 2 48774046
KASP Assay ID:
554-3104.1 (used for ordering genotyping assays)
KASP Sequence:
TGAGCAGCAGGATGCATCTGGACGAGGACTTCGACGCCATCTTTGGGAAA[C/T]AAACAACAATGTAAGNATCGATCGATCGATCTATCTATCTATCTATYTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33029
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 1483 2195 33 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49331423)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49034419
GRCz11 2 48768559
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGCTTCAGAACTGGCCACTTTTATCCAGCTGAACCATGATCTGGGTTG[T/A]CGAGCTGCGTTTGTGGAGACCATTGAAGAAGGAGTAAACGCACAAAGTCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2085
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Essential Splice Site 1516 2195 33 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49331322)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49034318
GRCz11 2 48768458
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCAGCCACAGAGTTCTGGAAGATCATCGGAGGACCCGCCAGCTACCAAC[G/A]TACTTCTCTTTAAACCATAATACAGTAGTCAACATTCAAAATGAATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25122
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Essential Splice Site 1774 2195 39 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49326172)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49029168
GRCz11 2 48763308
KASP Assay ID:
554-7816.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGGAGACGCGTATGTGCTCAAGTGGAAGTACATGGTGAGCGCAGCAGG[T/G]CAGTATCTGCACCGGGACACATGAGCTATTTATTCGGAAACTTGAATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33028
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 1912 2195 42 48
ENSDART00000134711 None None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49322410)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49025406
GRCz11 2 48759546
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTCAACATCAACAAAGCACTCATCTACCTGTGGCACGGCTGCAAAACA[C/T]AGACTCACTCACGGCATGTGGCTCGAACGGCAGCGGACAAAATCAAAGAA
Associated Phenotype:
Not determined