Busch Lab

ZMP

adcy2b

Ensembl ID:
ENSDARG00000014588
ZFIN ID:
ZDB-GENE-060503-69
Description:
adenylate cyclase type 2 [Source:RefSeq peptide;Acc:NP_001093457]
Human Orthologue:
ADCY2
Human Description:
adenylate cyclase 2 (brain) [Source:HGNC Symbol;Acc:233]
Mouse Orthologue:
Adcy2
Mouse Description:
adenylate cyclase 2 Gene [Source:MGI Symbol;Acc:MGI:99676]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13913 Nonsense Available for shipment Available now
sa10292 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4080
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046166 Essential Splice Site 470 1142 8 25
ENSDART00000135348 Essential Splice Site 470 1139 8 25
Genomic Location (Zv9):
Chromosome 19 (position 28161683)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28091795
GRCz11 19 27676018
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACATGATGTCACCCTGGCCAATCACATGGAGGCGGGCGGTGTTCCTGG[G/A]TAAAATCGTCARATGACTTTTGTTTTTCTCYCATTTCATGATTTTCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13913
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046166 Nonsense 920 1142 20 25
ENSDART00000135348 Nonsense 917 1139 20 25
Genomic Location (Zv9):
Chromosome 19 (position 28108912)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28039024
GRCz11 19 27623247
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGGGTGCTTTTRGAGAACGTTCTACCTGCCCATGTGGCCGAACATTTCT[T/A]GGGCCGGAACTGGAWGAATGAGGTAAGTGGTGTCCAAATGTCTAAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10292
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046166 Nonsense 1137 1142 25 25
ENSDART00000135348 Nonsense 1134 1139 25 25
Genomic Location (Zv9):
Chromosome 19 (position 28095611)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28025723
GRCz11 19 27609946
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGATCTGCGAAYCTTCTTYGTCCACACCGAGATGACGCAGTCTTTATCA[C/T]AAGGGAWTGTAATGCCTTGAACCCAAGTCCCACACATCGTACACGATATT
Associated Phenotype:
Not determined