Busch Lab

ZMP

slc38a3

Ensembl ID:
ENSDARG00000014587
ZFIN ID:
ZDB-GENE-040718-395
Description:
solute carrier family 38, member 3 [Source:RefSeq peptide;Acc:NP_001002648]
Human Orthologue:
SLC38A5
Human Description:
solute carrier family 38, member 5 [Source:HGNC Symbol;Acc:18070]
Mouse Orthologue:
Slc38a5
Mouse Description:
solute carrier family 38, member 5 Gene [Source:MGI Symbol;Acc:MGI:2148066]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa11448 Essential Splice Site Available for shipment Available now
sa27196 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41194 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11448
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025024 Essential Splice Site 43 472 3 16

The following transcripts of ENSDARG00000014587 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 24448255)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23574073
GRCz11 8 23595312
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTTTTTGCCACACAAGAGTGATGGAGGAAAAACCCCTCAGTTTACAGAC[G/A]TGAGTGCAGAAATTAAGATACAGCTCATAATTTGAGGCTCATATTARGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27196
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025024 Essential Splice Site 212 472 9 16

The following transcripts of ENSDARG00000014587 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 24442888)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23568706
GRCz11 8 23589945
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTACACCAGTGGCTTCTCTCTGACATGTATGGTATTCTTCTTGATCTCA[G/A]TAAGTGTTATTAAAAGTATTTAATGCTGTGGCTTTTGTGTGGTCTTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41194
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025024 Essential Splice Site 438 472 None 16

The following transcripts of ENSDARG00000014587 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 24436344)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23562162
GRCz11 8 23583401
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCGTTTCCCCTGAGCAAGAACCAATGAACTCAAGACCAAAAATTCTGG[T/A]GAGTCTCAAGCTTTTTCTGCTTCCTGCATCGATACATGGTTAAAAACAAT
Associated Phenotype:
Not determined