Busch Lab

ZMP

exoc3

Ensembl ID:
ENSDARG00000014582
ZFIN ID:
ZDB-GENE-030131-5947
Description:
exocyst complex component 3 [Source:RefSeq peptide;Acc:NP_997880]
Human Orthologue:
EXOC3
Human Description:
exocyst complex component 3 [Source:HGNC Symbol;Acc:30378]
Mouse Orthologue:
Exoc3
Mouse Description:
exocyst complex component 3 Gene [Source:MGI Symbol;Acc:MGI:2443972]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa19896 Essential Splice Site Available for shipment Available now
sa39943 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa19896
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009347 Essential Splice Site 431 748 7 13

The following transcripts of ENSDARG00000014582 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 50684107)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50379639
GRCz11 2 50113869
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTTTAATCCCCCTACTTATACGAGTTCAACATGAGATCCTCCTCTTCA[G/A]ATGTTCGAGCAGAATCTTCAGGTCGCCGCTCAGATTAATGAGATCTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39943
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009347 Essential Splice Site 501 748 8 13

The following transcripts of ENSDARG00000014582 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 50681564)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50377096
GRCz11 2 50111326
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTACGTTCAGTATATGATCGCCATCATCAACAACTGCCAGACCTTCAA[G/A]TGAGTTTCTCTTATCAGTTTTTGATTTATTAATTTTGAAGTCGAACATTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25921
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009347 Nonsense 602 748 11 13

The following transcripts of ENSDARG00000014582 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 50678480)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50374012
GRCz11 2 50108242
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTATTGAGCAGGAAATGACAAGCGTGGCTCATCGGCGGGTGGTGTTT[G/T]AGTATCTTAAAGCCATCATGTATAAGCGCATCTCCTTTAAGAATGCAGAC
Associated Phenotype:
Not determined