Busch Lab

ZMP

ca2

Ensembl ID:
ENSDARG00000014488
ZFIN ID:
ZDB-GENE-031219-5
Description:
carbonic anhydrase II [Source:RefSeq peptide;Acc:NP_954685]
Human Orthologues:
CA1, CA13, CA2, CA3
Human Descriptions:
carbonic anhydrase I [Source:HGNC Symbol;Acc:1368]
carbonic anhydrase II [Source:HGNC Symbol;Acc:1373]
carbonic anhydrase III, muscle specific [Source:HGNC Symbol;Acc:1374]
carbonic anhydrase XIII [Source:HGNC Symbol;Acc:14914]
Mouse Orthologues:
Car1, Car13, Car2, Car3
Mouse Descriptions:
carbonic anhydrase 1 Gene [Source:MGI Symbol;Acc:MGI:88268]
carbonic anhydrase 13 Gene [Source:MGI Symbol;Acc:MGI:1931322]
carbonic anhydrase 2 Gene [Source:MGI Symbol;Acc:MGI:88269]
carbonic anhydrase 3 Gene [Source:MGI Symbol;Acc:MGI:88270]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa24528 Nonsense Available for shipment Available now
sa37925 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24527 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24528
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038364 Nonsense 74 260 2 8
Genomic Location (Zv9):
Chromosome 24 (position 33867488)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32747415
GRCz11 24 32662058
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGACATCCAGAACAATGGACACTCTTTCCAAGTGTCCTTCGTTGATGAT[C/T]AAAACAGCTCAAGTGTGTGACGCTTCTTCATTTTTTATACAAAACACTCA
Long Flanking Sequence:
TTTCTATTATAATAAGGGACTAAGTTAAAAAGAAAATTAATGAATGTATATTATATTAATATGATCATATTCACATTTACACTATTATTATTATTATTATTATTATTATTATTATTATTAATAATAATAATAATAATATAAGTATTATTATTATTGAGTGCATTTTATTTATTTCTTTAATTATATAAAAGGTATTAAGTCTATTAATAGGCAAAACATCTTTTAAAACAAATATGTGTTACTTGGTTCAAGAATAAGTACATTATCATGCACTGTAAATGCTGTGTTTAACCTTCATTTCTCATTTCTCTGCAGGCCCAGACAAATGGGGTGAGAGTTACCCGATAGCGAACGGCTCTCGCCAGTCTCCAATAGACATTAAGAGCTCAACAACAACCTATGATGAAAAGCTGACTCCTCTGAAACTGAAGTATGACCCGTCCACATCTCTGGACATCCAGAACAATGGACACTCTTTCCAAGTGTCCTTCGTTGATGAT[C/T]AAAACAGCTCAAGTGTGTGACGCTTCTTCATTTTTTATACAAAACACTCACTCTGAACTTCCTCAATGTTAGTCATGAGCTTCCTTTCGAAGGTTCTTTATGTTCAGCTAGAGTAATGTAGACGGATGAGTTATATAACAAAAAACTGCTCTGGAGCTCAAACACTATCACTTCCACATCTACTTAAAAAAAAAAAAACCTGTTATACACACTTTCTATTTTCTAGTCTATGTTTAATAAAAATTCTATCAATTTAAATTTTGTTACTCTATTTTGAATTTCTTTTCTCTCAATTTCTAATCAATTTTCTATCACTATCACTTTCCAACCTAATAATTATTAACCTTTATACCTAATAATGTCATTCAGCTAAGTCCCTTATTTATCATGGGTCGCCACAGTGGAATGAACCGCCAACTATTCCAGCATATGTTTTGCACAGCGGATGCCCTTCCAGCTGCAACCAAGTACTGGGAAACACCCATACAGCCTCACATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37925
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038364 Essential Splice Site 78 260 3 8
Genomic Location (Zv9):
Chromosome 24 (position 33864301)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32744228
GRCz11 24 32658871
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCAAGTGTATGAAGCGGAGCATGACGGTTCTGATTTATTGTGTGTTTC[A/G]GCTCTGACTGGAGGCCCGGTCACAGGCACATTCAGACTCAAACAGTTTCA
Long Flanking Sequence:
GTTCATTCCGCTGTGGCAACCCCGGATTAAAAAAGGGACTAAGCCGACAAGAAAATGAATGAATGATGGGTTCCATGCAGTCTCTTCATGTTATCACAACCCAGATTGATTAAGTTAATGCAATTGTTTTAACTAATTTAAGTGCATTGAGCATAAAACAATTAAGTTGGCCTTAAAATAAAACTCAAAAATTGTGTTGTTTCAGCTAATTTTTTATTTGAACAAACAGGAAAAGTCATTTTTTAGAGTGTAGTATATAGTCTTTCTTGCTGCATGTCTAAGCAGGTGTAATGCCTAAAAACAAATGCATATGTGAAAATTTCAATGCAACTGCGCTTTACAGTGACACATCGGTTTTGGCACAGAATTGTGGGAAATCTCACGCAAATATTGCACTGAAGTGTTATTCACATTGAACTTTGTCAAAAAGAAAACCAGCATAACAGGTTTGCCCAAGTGTATGAAGCGGAGCATGACGGTTCTGATTTATTGTGTGTTTC[A/G]GCTCTGACTGGAGGCCCGGTCACAGGCACATTCAGACTCAAACAGTTTCACTTCCACTGGGGATCTGCAGACGACAAGGGCTCCGAACACACGGTCAATGGCAAATGTTACCCAGCTGAGGTCTGAATCGCTCCCAGTACTGACACAATGGAGACGCCAGAGAGTTTCTTTTGAAAATGAAATATTAATGCTTGTTTTACTTTCAACTTTAGCTCCATCTGGTCCACTGGAACACTAAATATCCCAGTTTTAAGGACGCAGTTGATAAGCCTGATGGTCTTGCTGTGGTTGGGGTTTTTCTGAAGGTTTGTGCGCAGGGTTATTTCATTATTTATGGCCGAATTATGAAGTATAACTGCTGCATCACTTTTGCTTATATTTTTATGCTAAAATAAAAGGCAAACGATTTTTAAATTATATATAAAAAGTAAAACAAATAATAATAAAAATAAAACAATTAAACTTATTATTGTACCTTAGTTGCATTCTTTTCACAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24527
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038364 Nonsense 89 260 3 8
Genomic Location (Zv9):
Chromosome 24 (position 33864267)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32744194
GRCz11 24 32658837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTATTGTGTGTTTCAGCTCTGACTGGAGGCCCGGTCACAGGCACATTC[A/T]GACTCAAACAGTTTCACTTCCACTGGGGATCTGCAGACGACAAGGGCTCC
Long Flanking Sequence:
GGGACTAAGCCGACAAGAAAATGAATGAATGATGGGTTCCATGCAGTCTCTTCATGTTATCACAACCCAGATTGATTAAGTTAATGCAATTGTTTTAACTAATTTAAGTGCATTGAGCATAAAACAATTAAGTTGGCCTTAAAATAAAACTCAAAAATTGTGTTGTTTCAGCTAATTTTTTATTTGAACAAACAGGAAAAGTCATTTTTTAGAGTGTAGTATATAGTCTTTCTTGCTGCATGTCTAAGCAGGTGTAATGCCTAAAAACAAATGCATATGTGAAAATTTCAATGCAACTGCGCTTTACAGTGACACATCGGTTTTGGCACAGAATTGTGGGAAATCTCACGCAAATATTGCACTGAAGTGTTATTCACATTGAACTTTGTCAAAAAGAAAACCAGCATAACAGGTTTGCCCAAGTGTATGAAGCGGAGCATGACGGTTCTGATTTATTGTGTGTTTCAGCTCTGACTGGAGGCCCGGTCACAGGCACATTC[A/T]GACTCAAACAGTTTCACTTCCACTGGGGATCTGCAGACGACAAGGGCTCCGAACACACGGTCAATGGCAAATGTTACCCAGCTGAGGTCTGAATCGCTCCCAGTACTGACACAATGGAGACGCCAGAGAGTTTCTTTTGAAAATGAAATATTAATGCTTGTTTTACTTTCAACTTTAGCTCCATCTGGTCCACTGGAACACTAAATATCCCAGTTTTAAGGACGCAGTTGATAAGCCTGATGGTCTTGCTGTGGTTGGGGTTTTTCTGAAGGTTTGTGCGCAGGGTTATTTCATTATTTATGGCCGAATTATGAAGTATAACTGCTGCATCACTTTTGCTTATATTTTTATGCTAAAATAAAAGGCAAACGATTTTTAAATTATATATAAAAAGTAAAACAAATAATAATAAAAATAAAACAATTAAACTTATTATTGTACCTTAGTTGCATTCTTTTCACAATTTTTACAACTAAAATAAAAGAAAATCAAAACATTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3264
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038364 Essential Splice Site 117 260 3 8
Genomic Location (Zv9):
Chromosome 24 (position 33864179)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32744106
GRCz11 24 32658749
KASP Assay ID:
554-2932.1 (used for ordering genotyping assays)
KASP Sequence:
YGACAAGGGCTCCGAACACACGGTCAATGGCAAATGTTACCCAGCTGAGG[T/G]CTGAATCGCTCCCAGTACTGACACAATGGAGACGCCAGAGAGTTTCTTTT
Long Flanking Sequence:
ATTGTTTTAACTAATTTAAGTGCATTGAGCATAAAACAATTAAGTTGGCCTTAAAATAAAACTCAAAAATTGTGTTGTTTCAGCTAATTTTTTATTTGAACAAACAGGAAAAGTCATTTTTTAGAGTGTAGTATATAGTCTTTCTTGCTGCATGTCTAAGCAGGTGTAATGCCTAAAAACAAATGCATATGTGAAAATTTCAATGCAACTGCGCTTTACAGTGACACATCGGTTTTGGCACAGAATTGTGGGAAATCTCACGCAAATATTGCACTGAAGTGTTATTCACATTGAACTTTGTCAAAAAGAAAACCAGCATAACAGGTTTGCCCAAGTGTATGAAGCGGAGCATGACGGTTCTGATTTATTGTGTGTTTCAGCTCTGACTGGAGGCCCGGTCACAGGCACATTCAGACTCAAACAGTTTCACTTCCACTGGGGATCTGCAGACGACAAGGGCTCCGAACACACGGTCAATGGCAAATGTTACCCAGCTGAGG[T/G]CTGAATCGCTCCCAGTACTGACACAATGGAGACGCCAGAGAGTTTCTTTTGAAAATGAAATATTAATGCTTGTTTTACTTTCAACTTTAGCTCCATCTGGTCCACTGGAACACTAAATATCCCAGTTTTAAGGACGCAGTTGATAAGCCTGATGGTCTTGCTGTGGTTGGGGTTTTTCTGAAGGTTTGTGCGCAGGGTTATTTCATTATTTATGGCCGAATTATGAAGTATAACTGCTGCATCACTTTTGCTTATATTTTTATGCTAAAATAAAAGGCAAACGATTTTTAAATTATATATAAAAAGTAAAACAAATAATAATAAAAATAAAACAATTAAACTTATTATTGTACCTTAGTTGCATTCTTTTCACAATTTTTACAACTAAAATAAAAGAAAATCAAAACATTTATTAAAAAAACGCTAAAACAAAAAATTTTATATTGTATCGTATTCTCATTCTTTCGAAAATCGAACACAAAATTCAATGCAATCTCACG
Associated Phenotype:
Not determined