Busch Lab

ZMP

si:ch211-236p22.1

Ensembl ID:
ENSDARG00000014391
ZFIN ID:
ZDB-GENE-050419-118
Description:
Novel sushi domain containing protein [Source:UniProtKB/TrEMBL;Acc:Q1LVL7]
Human Orthologue:
CSMD3
Human Description:
CUB and Sushi multiple domains 3 [Source:HGNC Symbol;Acc:19291]
Mouse Orthologue:
Csmd3
Mouse Description:
CUB and Sushi multiple domains 3 Gene [Source:MGI Symbol;Acc:MGI:2386403]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa42822 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42821 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17497 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42822
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074570 None None 353 None 9
ENSDART00000143582 Essential Splice Site 58 429 1 10
Genomic Location (Zv9):
Chromosome 16 (position 50774849)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47628924
GRCz11 16 47564010
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTTGCCAAGCAGACGCCACATGGAGCGGCACTCAACCACGCTGCATAG[G/A]TATATTTACTTTTAAGAACGTTTTCCTCTTATCAATAAATACTTTATCAT
Long Flanking Sequence:
CCAAGACCTCATGCATCTGTTGCTAGAGCGCCTTTAGAAGTCAGAAGAGTGAGGTTTACCTGCACAGCACTTCCCTAGCTGGCCTCTGTTACACTCACCCCAATAAACCTAACTCTCATCCCGGACGAGCCCCCACATGTTACTCACCGGTCCTTTAATCCCAGCTCAGACTGTGTTGGGTGCAGGAGGACTGGTGGGTTACACACCTTTTAGGACTGGGGGGTTACACAACTTTTACTACAAATTGAAGCAATTTTATTTAGAAAACTCATTTCATTAATAGTCGACCTCAAAAGACTCGATCTTTTATTTCTTTGTCTCCTCAGCCAAGTTCTGTGGTGATCCAGGAATCCCGAGCCGGGCCAGACGAGAGGGTCAGAGCTTCATCTTTAAAGCTGAGGTGATGTTCAGCTGCAGCGCCCCCTATGTGCTGGTGGGCTCCTCGACACGCACTTGCCAAGCAGACGCCACATGGAGCGGCACTCAACCACGCTGCATAG[G/A]TATATTTACTTTTAAGAACGTTTTCCTCTTATCAATAAATACTTTATCATTTAATCTTTACTGTTTTTCTCAGTCGCTTTGGTACATTTCTCAGATAAGAATTGAAATTCTCTCCTGTTTAATCTTCAGGTCATTGTGCTACCTGTGTACATCAAAAAAGCAGTTTCTTTGAACAAGTTGCAAATGCTTTTGTACATCTATGCAAATGATTATGTATTCTCTGATGTTTCCTACTTTATCAGCTATTCATGTCATGTTGATCAAAATTCATTATTTTGGTCTCTGTTGAATAGTCTCATCCCACACAACGTTTAATTGTTCATGTTCATGGCAGTTTACATGCAAAAGGGCTGAACATACATTTAGATTTTTCTGTGTGCTATGCTGTGTTGTCTTTTCCTTTTTGTATCACAATGACATGATTGGTCAACAAACTACAACACAAACAGCAAAAATAATTACAAAATAGCCATAGTTTACATCAGAATATCCATCCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42821
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074570 Essential Splice Site 16 353 1 9
ENSDART00000143582 Essential Splice Site 83 429 2 10
Genomic Location (Zv9):
Chromosome 16 (position 50771505)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47625580
GRCz11 16 47560666
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCTGGCACTCCAGAATTCGGCTCTTTGAACAGCAGTCTGGGCTTTAAG[G/A]TAAGAAGCAGTGGAGCTTGGACTGTCTTGGCCTCTTATATCAAAGCCATT
Long Flanking Sequence:
GACAACGCGAGAGCCGTCCACTACGCCACTAATTGTACCTGGTATAGCCATTAAACTAATTTTCTAGTGAGATGCTAGTGGTCCAATCCAATTTAATGATTGATGCTAAGCTAAGCTAAAATTGTTCTCGTCAGACCCGAAGATCGTCTGAATGGGTTCAAAAATGATAAAACTCAACTAGTAAACTCCAATTTCCTATTTTCCCATCTAACTGCCTACTTGCAAAAAAAGGTGAAGTGTTCCTTTAACCTTGAATGTCACATCCATACACTCTTAATATCCACTCCAACTTTGATCTATGAACGTTACATGAACATTACGACCCTCTTCTCCAGGTCACAGCCATTACATCAACCGCTACATCTTCTTTTCATAATCCAATTATAAGGATCTGAAAATGACAGTTTCGTTCTTTCTTCACCGCAGAACCGACCCGAACGACTTGTGAAAACCCTGGCACTCCAGAATTCGGCTCTTTGAACAGCAGTCTGGGCTTTAAG[G/A]TAAGAAGCAGTGGAGCTTGGACTGTCTTGGCCTCTTATATCAAAGCCATTATGACGAGAGTTAGTTCAAAAGGCCCCATTTCTGTCAGTTGTAGCCTGCTTTTATCTTCAAGTGCGAAAACGGCCCCTTTCAAATGGCACAATGTGACTTTTGATGTGCCTATTAAGGGCTGAAAGTCATATTTTCCATCATCGCTGAGACAAAAGGATATTCGCTCGCCGGGTGACAGAATCATCCGAAGGCGTTAATGCCACATGAGAGAGTCGAGTGCGAGGTTTTGTCATCTTTCCGGACCGGCCCGTATTTTATGAGTGCAATTGATTTATTGTCAAGTTGATTCAGTCAAATGCTGTTTGAAGAGCAGTTTCAGGATGTGTGACTGACTGACTCTTAATGTCTGGAGAGAGTTTACTATTCAGACGCTCATGATATCCAGCCCAGTGCATTTGATGCCACTTTTAGGGTTAGTAGTGGTCAACTGTGTCAATGTTTTAATAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17497
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074570 Nonsense 41 353 2 9
ENSDART00000143582 Nonsense 108 429 3 10
Genomic Location (Zv9):
Chromosome 16 (position 50765159)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47619234
GRCz11 16 47554320
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGTCAGACGGGCCACTTGTTACTGGGCTCCACCACACGCACRTGTCAG[C/T]AGGATTTGACCTGGAGTGGCTCTCAACCTGAATGCATCCGTGAGTCTCAC
Long Flanking Sequence:
CAAATCCGTTGCTAAGGCATACTTTATGTAGGTCGATTAAATTATGCGCCAAAAACAGGTTGACAACACTTGTTAATAAATACAAAATACATTCTATATTAAAAATATAAGCTGTATCTCGCAAAAACCGATGCATCTTGATTTGCTTCCAAAATTTCATTCATCCTCTGCTGCTCTACCGATGCACTCGCATTGTGCACGCGCATGACCGCGTATCGATACATATCGATTAATCTTCCCATCCCTACTGTAGACTGATGTAATTTTATGCCGTTCAGGCTTATAACCGTAATATGTGAGCAAAAATTATTCCCTATTCTGGGTCACCATGGGTTGAGAGGACGTGAATGCGGTGTGTGGGTGTATATATGTATGTGTCTGTGCTGTGTATGTGTGTGTTTTCTGACAGGCTTATCTCTGCTTCTCAGGTTGGTAGTACAGTGAAGTTTGTCTGTCAGACGGGCCACTTGTTACTGGGCTCCACCACACGCACGTGTCAG[C/T]AGGATTTGACCTGGAGTGGCTCTCAACCTGAATGCATCCGTGAGTCTCACTCACTCAACACACACACACAGACAGACTGGTTCTTATATCTCTGTGGGGACTCTGATAGACGTAATGATGTTTCTACTATATAAACATTATATTCTTTCCCTCTACCCCTAAACCAAACCCACAGAGGACACACTCTGCATTTTTACATTTTCAAAATAAATCATTCTGTGTGATTTAAAAGCATGTTTACCTCAATTTTGTTTACCTCAAGTCCCCTTAAGTCTGTGTGCAGTCAGGTTTGAGTCCCCATTGGGATATGAAAACAAGTACACACACATGCACACACTTCTACATGATTTTGGTGCATTTGTGTGTGTGTTGTACTTCATCTTTTCAGGATTTTTTTTTTTGAGGCAAGTCATCTATTTTGCAAGTTATGTTATAACATTTATTTCCCCCTGCAGGAGATTTGTTTTCCATATGCACGTCATTCCATATGAAAGTGAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28744
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074570 Nonsense 253 353 7 9
ENSDART00000143582 Nonsense 320 429 8 10
Genomic Location (Zv9):
Chromosome 16 (position 50748706)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47602781
GRCz11 16 47537867
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTGTTTCAAGGCTTTATACAAGGTAGAGACTACGGCCCATTTGGACTA[C/T]AGAGACAAGGTACGCTACATGTCGACAATGCAAGTAGTGAGTAAAGACTA
Long Flanking Sequence:
GTTCAGTATAATTACCTTCAGAACTGTCTTGGCTTTTCCGATTGCAGCAAACTCTTTTTTTGATATCTGGCTCCAGTTTATCAGGAATTTTGTTCTCTTTGACTCATTGGATGAAAACTATGCCTTATTTGCAAACGTTTTATGCAATAATCCAGTTTTGTGTATAAATCTAATTCACATCTTTGGATGGAAACATAACTATTGGTTGTATTTGCTGTAGGTTAAGTGCAGAACAGATATCTTCCCTGTGCAGTAATATCATGGTGTATATATCTGCCTATTATTAAACTTGGCAGTGTAAGAGAAGCTGTATTCTGAGAGCAATAGACTTCATCACAATGCGATATTGCACAGAACATCTGCTGTATTGAGAAGAATATGAGAGAACATGATGTTCATGTCTTGTTGTTCTTCTCCTCGAGGTCTCTGCTGACCATGAAGGAAACACATACTTGTTTCAAGGCTTTATACAAGGTAGAGACTACGGCCCATTTGGACTA[C/T]AGAGACAAGGTACGCTACATGTCGACAATGCAAGTAGTGAGTAAAGACTAATTGTGTTTATATATATATATATATATATATATATATATATATATATATATATATAGGACGTAGGACAACACTGCAGAAATGACTGTTTGACACAATGAATTGTAGTCAGTATAAAGTGTTTATAGCAGTGTAAATTTATTTTCCTCTCAAAATAACTACAAATACAGCCAATAATAGCTGAACCCCTGGCAATAAAAGTGAGTATTTATTTATTTATATATGTATATATCACCAGGTTACACTTACATTTAGTGACGGTCTGAAAACATGGACGGTGTCATCATTATATTGTTAATTTAATATACAAATCTCATTATAGACACTAAGCAACAGCTATAATTTACATTTAATGGAAAGTCAGTACTATTCATTTAAATCACCTCTTTGAGATAATTGTCTTAAACACGTAGTTTGCAATGTAAAACTGAACATATGTAATTCACTATGGC
Associated Phenotype:
Not determined