Busch Lab

ZMP

im:7162646

Ensembl ID:
ENSDARG00000014378
ZFIN ID:
ZDB-GENE-090218-27
Description:
LOC562826 protein [Source:UniProtKB/TrEMBL;Acc:Q4VBH0]
Human Orthologue:
SLC12A4
Human Description:
solute carrier family 12 (potassium/chloride transporters), member 4 [Source:HGNC Symbol;Acc:10913]
Mouse Orthologue:
Slc12a4
Mouse Description:
solute carrier family 12, member 4 Gene [Source:MGI Symbol;Acc:MGI:1309465]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa18878 Nonsense Mutation detected in F1 DNA Not yet available
sa11950 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8274
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005053 Essential Splice Site 234 1095 6 24
Genomic Location (Zv9):
Chromosome 7 (position 36755790)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 35029633
GRCz11 7 35301110
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAACCTTCGCTGCTGCCATGTACATATTGGGAGCAATTGAAATATTTCTG[G/T]TCAGTCTTCTTTTATTWTAATCACACACAAAGCATGATCTAAWCTCAAAG
Long Flanking Sequence:
GTTTTGGGTGAACTATGCCTTTAAGAAAATGCTGCTTGATCAAAAGGATAATATATAACAAAGTGTTATTGTTTTTATTAATGTTTAACTGTATGATTTGACTTCTTATGTATTATGACTTCAGTGTGATTGATTTCTTTTTTGTTTTATTGTCTTATTTATTTTATTATCTGTATTTTTATTTTTAACAGACAATGTTGACAGCAATCTCGATGAGTGCCATAGCCACCAATGGTGTAGTTCCAGGTAATTTGAAATGTTTATACTAATGGTTATCAGGACAACTGGAAATAGTTATTCTTCTGAATGGTTACATCCTATAAAATCAACATAACTGTAGAAATTTATTTATTTACTTTTCCCTTTCAGCTGGTGGGGCTTATTTCATGATATCTCGCTCTCTGGGCCCTGAGTTCGGTGGTGCTGTTGGTCTCTGTTTTTATTTAGGTACAACCTTCGCTGCTGCCATGTACATATTGGGAGCAATTGAAATATTTCTG[G/T]TCAGTCTTCTTTTATTTTAATCACACACAAAGCATGATCTAATCTCAAAGCCACCCAGATCTGACAATAATAATTCTTCAACTCTTATTTTTCACAGAAATATCTGATTCCTCAGGCTGCCATATTCCATCCAGCAGATATTCACGCAGGAAACGGTGCAATGCTGAATAACATGCGGGTTTATGGCACAATATGTTTAAGCCTCATGGCTGTGGTTGTTTTTGTGGGGGTCAAATATGTCAACAAATTAGCCTCGCTGTTCCTAGCCTGCGTCATAATCTCCATTGTTTCTATCTATGCTGGAGCGGTCAAGTCCATCTTCCACCCTCCTGAGTTTCCGTAAGTTTTTCTGTAATACTTAAATATTGGGACAAATAATATACAATCATAAAAAAAGGAAAAATATGGGACAAACAATACTGGGATAAATATTAAATATATATATTGTATATAGGGTGGCATTATTTTACATTTTTTTAAATTTAATAAATTGTGTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18878
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005053 Nonsense 646 1095 15 24
ENSDART00000005053 Nonsense 646 1095 15 24
Genomic Location (Zv9):
Chromosome 7 (position 36749538)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 35023381
GRCz11 7 35294858
KASP Assay ID:
554-6141.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGGCATGAGTATGTGTTTAGCCCTTATGTTCATCTCCTCTTGGTACTA[T/A]GCCATTGTAGCGATGGGCATTGCCGGAATGATCTACAAGTACATTGAGTA
Long Flanking Sequence:
TTCATTTATTTGATCTTATTTGTGGAAACTCTTCACTTGTAGTCACATTTGAATTTAGGCCAAACTGTCTCAAACTCAAAACTCTCAGCCCTTGATTTCCACTATTCACTTCCAGCCATTGTTTACAAATGAACTTTATTAAAGGGACAGTTCACACAATAATGAAAACCTTGCTGAACAACAAAGAAGATCATTTGAAAAAGTTGGAAACTGCTAACCATTGACATCTATAGTAGAATAAACAAATGCTATAGATTTGAATAGTTACAGGTATCCAACATACTTCTAGATATCTCCTTTTGAGTTCAATTAAACAAAAGTAAATGTCAATGAATAAATAAATGTTCATTTTTAATTGTATTATCCCTTTAAATCAATTTCTGCTATTGTAACAATCATGCAGAGTCTTTTATGATATGTTGTATGTTGTCTCTTAGGGCTCTGTCTTTTCTGGGCATGAGTATGTGTTTAGCCCTTATGTTCATCTCCTCTTGGTACTA[T/A]GCCATTGTAGCGATGGGCATTGCCGGAATGATCTACAAGTACATTGAGTATCAGGGGTGAGTGCTTCTTAATTGCACCCATTAAACTGATATGAATCGCTGGAAAGCACTTAAAGAGGAATTGTAGCTCCCCACATTTGGTCCAAATCTCCGCTTGGTGTTTTCTTGTGTTTTAGAGCAGAGAAGGAATGGGGTGATGGGATCCGTGGTTTGTCTCTGAGCGCCGCCCGCTACTCTCTGCTTCGCCTGGAGGCTGGACCACCCCACACCAAAAACTGGAGGTTGTGTCTTAGTTTGACAACTGTGTTTGTTTTCCACAGTAAAATAATTCTTAAAAATTAAAAAAAAAAAAAAAAAAAGAAATATACATTGTCAGTGCAGTAAAATTTTACTTAAATATCATGATTGGCCATTTTTCAAAACTTTTGAAAATGAATTTGATAATGACTGGGGAACACCTTCAATATTGTTTGATAAGCTGGAGGATGTTGTTTGATTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11950
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005053 Nonsense 646 1095 15 24
ENSDART00000005053 Nonsense 646 1095 15 24
Genomic Location (Zv9):
Chromosome 7 (position 36749538)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 35023381
GRCz11 7 35294858
KASP Assay ID:
554-6141.1 (used for ordering genotyping assays)
KASP Sequence:
CTGGGCATGAGTAYGTGTTTAGCCCTTATGTTCATCTCCTCTTGGTACTA[T/A]GCCATTGTAGCGATGGGCATTGCCGGAATGATCTACAAGTACATTGAGWA
Long Flanking Sequence:
TTCATTTATTTGATCTTATTTGTGGAAACTCTTCACTTGTAGTCACATTTGAATTTAGGCCAAACTGTCTCAAACTCAAAACTCTCAGCCCTTGATTTCCACTATTCACTTCCAGCCATTGTTTACAAATGAACTTTATTAAAGGGACAGTTCACACAATAATGAAAACCTTGCTGAACAACAAAGAAGATCATTTGAAAAAGTTGGAAACTGCTAACCATTGACATCTATAGTAGAATAAACAAATGCTATAGATTTGAATAGTTACAGGTATCCAACATACTTCTAGATATCTCCTTTTGAGTTCAATTAAACAAAAGTAAATGTCAATGAATAAATAAATGTTCATTTTTAATTGTATTATCCCTTTAAATCAATTTCTGCTATTGTAACAATCATGCAGAGTCTTTTATGATATGTTGTATGTTGTCTCTTAGGGCTCTGTCTTTTCTGGGCATGAGTATGTGTTTAGCCCTTATGTTCATCTCCTCTTGGTACTA[T/A]GCCATTGTAGCGATGGGCATTGCCGGAATGATCTACAAGTACATTGAGTATCAGGGGTGAGTGCTTCTTAATTGCACCCATTAAACTGATATGAATCGCTGGAAAGCACTTAAAGAGGAATTGTAGCTCCCCACATTTGGTCCAAATCTCCGCTTGGTGTTTTCTTGTGTTTTAGAGCAGAGAAGGAATGGGGTGATGGGATCCGTGGTTTGTCTCTGAGCGCCGCCCGCTACTCTCTGCTTCGCCTGGAGGCTGGACCACCCCACACCAAAAACTGGAGGTTGTGTCTTAGTTTGACAACTGTGTTTGTTTTCCACAGTAAAATAATTCTTAAAAATTAAAAAAAAAAAAAAAAAAAGAAATATACATTGTCAGTGCAGTAAAATTTTACTTAAATATCATGATTGGCCATTTTTCAAAACTTTTGAAAATGAATTTGATAATGACTGGGGAACACCTTCAATATTGTTTGATAAGCTGGAGGATGTTGTTTGATTAAT
Associated Phenotype:
Not determined