Busch Lab

ZMP

vasa

Ensembl ID:
ENSDARG00000014373
ZFIN IDs:
ZDB-GENE-990415-272, ZDB-GENE-990415-272, ZDB-GENE-990415-272
Description:
probable ATP-dependent RNA helicase DDX4 [Source:RefSeq peptide;Acc:NP_571132]
Human Orthologue:
DDX4
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 [Source:HGNC Symbol;Acc:18700]
Mouse Orthologue:
Ddx4
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 Gene [Source:MGI Symbol;Acc:MGI:102670]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa15900 Essential Splice Site Available for shipment Available now
sa6158 Nonsense Mutation detected in F1 DNA Not yet available
sa18973 Nonsense Mutation detected in F1 DNA Not yet available
sa9472 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15900
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105384 Essential Splice Site 65 700 6 26
ENSDART00000121729 Essential Splice Site 82 715 6 26
ENSDART00000125262 Essential Splice Site 65 688 6 25
ENSDART00000128866 Essential Splice Site 81 716 7 27
Genomic Location (Zv9):
Chromosome 10 (position 6557550)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6934178
GRCz11 10 6892878
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGGGAGGATCACGAGGAGGCAGAGGAGGCTTTAGCGGTTTTAAATCAGG[T/C]GAAATTTATATGCATGCTTGATTTGAAGCTGTCAGTTTAATCTGGTATAA
Long Flanking Sequence:
GTAGTGCATAATGACACTGGGTATACTGACCCCACCTTTCTATTAGATTTAGTTTGTGGTGATGAGATAAATGCAAGTGCTTCAATGTCTGATTTGGCCTTTGGCGAGACAGTTCACATTTTTAAGCTTAAAGAAAAATTCAGGGGTTTGTCACTGTGATTATCAATCTGGTTGTTGTATCTGTTTTTTGTAGCTTCTGTCATTTAAAAGTGCTTAAGTATGCAGCATACAGATCTGATCATCTGAAATGTCATGTTTGCAGGTACTGAAGGTAGCTCATGGAAAATGACTGGTGATTCGTTCAGGGGGAGAGGTAAGAAGGGGAGGAGTCTGAAATTAAATAACAGTGTTTCGCTAGTTCACATTGTTATTCTTAATGTGATGGGCAAATGTGCATTTTGCCAACTTGCATAGTGAAAGCTTTTGTCTTATGGCATGTTTTCAGGAGGCAGGGGAGGATCACGAGGAGGCAGAGGAGGCTTTAGCGGTTTTAAATCAGG[T/C]GAAATTTATATGCATGCTTGATTTGAAGCTGTCAGTTTAATCTGGTATAAAAATACAGTTTTTAGTTAATTTTTATTCTAAACAGCTTTGTAACAGCAAAAAAAAAAACATCACAAATTAAGGAACGTGCATAAACTAGTTTATGTATTAAATTAGATTTAATTGAGTTACTTTTATTCTGAGTGTCACAATACACCAATGCCGTAGTTTGGTTCAGTTTCCAGAGGGAGCAGGGCTTGTGCTGTTTCATCAGCAATGTTATTAAACACCAGATTCACTTTTGACTTGACTTAAATAGCACTAGCTTCATGTTAGTCAACTGATCTGGGTAAATCAAAATCTCCATATCAGAATAGTCAGAAATAAACCGCTTCCATACAGTACATTTGGAATGTTACAAAATGCTTGAAATACTCAATCTGAATAACAGCAGTATAAATCACTGCTCTCCCTTTAAGGCATTTATCAGCTTTCGAACATTAATTGTTTGAGTTCACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6158
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105384 Nonsense 205 700 16 26
ENSDART00000121729 Nonsense 219 715 16 26
ENSDART00000125262 Nonsense 193 688 15 25
ENSDART00000128866 Nonsense 221 716 17 27
Genomic Location (Zv9):
Chromosome 10 (position 6561271)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6937899
GRCz11 10 6896599
KASP Assay ID:
554-5272.1 (used for ordering genotyping assays)
KASP Sequence:
TAATCCATTTTAWTGTTTTCCTGTTTGTTCAGTCACAACTGCAGACAAGT[T/A]GGATCAAGAAGGAAGTGAAAATGCAGGTGGGCANNATGTTATACATAAAG
Long Flanking Sequence:
GCGATTTCAACCAAAATAAGCAATTACACCCTATCAAACATATCTATAATAAGGAGCATGGTTGGTTACGGAGTTATTAACGCCACAAGACCAAACTAGGAAAGGATGGACTTTGAAGGAATAAACTATGGCAGGAAAGCTTCATTAAATTGCACTGAACAAGTTCTGGCCATGCATGCTCGAGGCAGGCAATTCCGTACAATTGCGTAATTTAGCAGCTTAAATTTATCGAGCTAATTATGACATCGGACCCATAACAATAAACTTAAAAGTAGCATTTATTGGCTGATAAACGATATGACCGTCTATATCTTGCATCCCTAAAATTAATCTATTTCTTTGACTACTGTTCAGGTTTTAGAGGCCGGAATGAGGAAGTATTTTCCAAGGGTAATTTACTGCATTTATATAAAATGTTCTAAAGTGTTAACTTTTTTTTTTATTATTATTTAATCCATTTTATTGTTTTCCTGTTTGTTCAGTCACAACTGCAGACAAGT[T/A]GGATCAAGAAGGAAGTGAAAATGCAGGTGGGCAATATGTTATACATAAAGTAATCATCATGTTAAAATTGATTTAAGGAATTGGGGAGGAAGTAGAATTGATGGTCTTTAAACGAATTGTCTCGTAAATTGCTAAATTTTATACAAGAAGTGTTTTCCATAGTTTTTGGAGCTGACTTGCAAAAGATCAGATACAATTTAAGGACTGATTTAATACCAGACATTTTAATCATGGTGTTTGAGTCTTTTTGCTCTTAAATGACTGATATTAAAGAGGAGGAGAGAGTTGTAGTTTGAAGTGATAGATTTTCATCTGATAAAGTATTGCTTCAAGTAAATTGAATGGCCTTTTTTTTTTCAGGACCCAAGGTTGTTTATGTGCCGCCGCCTCCTCCAGAGGAGGAGAGCTCGATATTCTCCCATTATGCAACAGGCATTAATTTTGACAAATATGATGATATTCTTGTGGACGTGAGTGGCAGCAATCCTCCAAAAGCAATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27556
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105384 Nonsense 277 700 18 26
ENSDART00000121729 Nonsense 292 715 18 26
ENSDART00000125262 Nonsense 265 688 17 25
ENSDART00000128866 Nonsense 293 716 19 27
Genomic Location (Zv9):
Chromosome 10 (position 6562360)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6938988
GRCz11 10 6897688
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGACTTTTGAGGAAGCAGGACTTTGTGACTCACTGAGCAAAAATGTAT[C/A]AAAGTCTGGATATGTGAAGCCTACACCTGTTCAGAAACATGGCATTCCCA
Long Flanking Sequence:
CATATTGGCATTGTCATGTGATGTGGTGAAAGTATGTGGGTAGAATTTATCTACTGTTTTATAAACTCTAAATAGTTGCATTTTAAAACAATAAGAACATTTCAGCATTTTAAGTCATAATGGGTGACAACATTCCTAATGTAGTTTCTAAACGTGTTGTCTCTGTGTGTGCTTTTCAGAGATCATAATTTGCTTTTCGCCAACGTTTTTATTCCTTTTATAACCTTCACAGAAACCTTTTTGCGTTTATCTATAAAACATGGTTTGGAATCAAGTCTAAATATTTAATATTCTGAACTATTTAATACAAACACTGAACTGCTTGTGAAATGTCACAACCTGAAGCACCACTAGATGGAGAGTTTGCAAGTGAACTGAACAAGGGGTGTTGTACAACTGCATATAACAGCTAAAAATACTACAAAATCAAACTTTGTTGTTTTTTTCCTTTTAGACTTTTGAGGAAGCAGGACTTTGTGACTCACTGAGCAAAAATGTAT[C/A]AAAGTCTGGATATGTGAAGCCTACACCTGTTCAGAAACATGGCATTCCCATCATTTCAGCTGGACGGGATCTAATGGCTTGTGCTCAGACTGGATCAGGAAAAACGGCAAGAACAAGCTCTTATGACTTCTAATTACGTTTAATTTATACTTGCTTTTTTTTATATATTTGTGAGATGTTGTGGTTTATTAATTAGTAGAAAATTGGTTCATATGATGATTGTTTGCTCACTCTGACATCACTCAGGCGGCCTTCCTGCTGCCTATCCTACAGCGCTTTATGACTGATGGTGTGGCAGCCAGCAAGTTCAGTGAGATACAGGAGCCTGAGGCCATAATCGTGGCTCCCACCAGAGAACTTATCAATCAGATCTATCTGGAGGCCAGGAAGTTTGCATACGGGTACACTAAACTATTTTGAATTTATTTATTTATTTTTTTGTGCAACAAGCTGGTCTAATGTTTTGTGGCTTTTGTATCTCCAATGTAGTGTCATCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18973
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105384 Nonsense 684 700 26 26
ENSDART00000121729 Nonsense 699 715 26 26
ENSDART00000125262 Nonsense 672 688 25 25
ENSDART00000128866 Nonsense 700 716 27 27
ENSDART00000105384 Nonsense 684 700 26 26
ENSDART00000121729 Nonsense 699 715 26 26
ENSDART00000125262 Nonsense 672 688 25 25
ENSDART00000128866 Nonsense 700 716 27 27
Genomic Location (Zv9):
Chromosome 10 (position 6569553)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6946181
GRCz11 10 6904881
KASP Assay ID:
2260-2843.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTCTTATTTGTAGGGAGGATCCTTCAAGAGCGATGAGCCGCCACCATCA[C/T]AAACATCTGCCCCGAGCGCAGCAGCTGCTGCAGACGATGAGGAATGGGAA
Long Flanking Sequence:
GCGTTGACGCTGAAGTCCCGTGTGAATATGGCGTTACTGTTACCCTGTAACTGAACACTCCTCAACAGAAGATAAACAGAGGAGATCAGCTCAGCCAAAAGGAGTTAAAAATCAAACATCCCTATTTTATAAGTTGAATTCCTTTTCATGTCTGAAGTTTATGAGCCTTTTTGATTGATCTACCAATTTAAATAACTCCTCCCACCACCCGTAACTTAGATAACCTTGTTGCATAAAGTTTATTTGCTTAATGTTCAGTGAATAAGTCAGTGTATGCGCTCAAAATAGTTTATCAAAGGACAACAGTGTCCTGGCTTAACTGGCTTAACATCTTTATTACTGAAGAAAGTCACCTACATCCTGGATGGCCTGAGGATGAAAGCAGCATTTATTTTTGGATGAACTTAAAGTTGAGTTTCTGAATGCTGTGGTAAACTTGAGTGTCTAAATGGTCTTATTTGTAGGGAGGATCCTTCAAGAGCGATGAGCCGCCACCATCA[C/T]AAACATCTGCCCCGAGCGCAGCAGCTGCTGCAGACGATGAGGAATGGGAATAACTGGCCTCACACCTGTTATATTTATTTTATTTTTATTTTATTTGTGCGAGCTTCTTCAATACCATTTCAGGATATTTGTTAATGTTGAATGACTAAAGTAGCATTAGGATAAAGCTGTTGTATTTAGAGTCACATTGAATGCTGTAGGTTTGACCTCAAGGACGATAATCAAGACTAATACCTTTTGGCAGTTTAATTTGATCATCTTTTTGGTATCACTCGTTTTGACTGGAGCACATCTGAAATAGTGGATTTGTTTTACTAGAGCACAAGTGCAGAAGTGGGTGGGTTTGTTTAATCACATTTTAACACTTTGCTAGGAGTGTATTGAGTTTTGTAAGCTTTGACCTAAAGGTGTTTCCTACAGTTAAATCTATTAATCAGTTCTATTGTTGATTGTGACTGTTTGTAGGTTATTTTTCTTGACATTTCCGTCTTGAAGCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9472
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105384 Nonsense 684 700 26 26
ENSDART00000121729 Nonsense 699 715 26 26
ENSDART00000125262 Nonsense 672 688 25 25
ENSDART00000128866 Nonsense 700 716 27 27
ENSDART00000105384 Nonsense 684 700 26 26
ENSDART00000121729 Nonsense 699 715 26 26
ENSDART00000125262 Nonsense 672 688 25 25
ENSDART00000128866 Nonsense 700 716 27 27
Genomic Location (Zv9):
Chromosome 10 (position 6569553)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6946181
GRCz11 10 6904881
KASP Assay ID:
2260-2843.1 (used for ordering genotyping assays)
KASP Sequence:
GGTCTTATTTGTAGGGAGGATCCTTYAAGAGCGATGAGCCGCCACCATCA[C/T]AAACATCTGCCCCGAGYGCAGCAGCTGCTGCAGACGATGAGGAATGGGAA
Long Flanking Sequence:
GCGTTGACGCTGAAGTCCCGTGTGAATATGGCGTTACTGTTACCCTGTAACTGAACACTCCTCAACAGAAGATAAACAGAGGAGATCAGCTCAGCCAAAAGGAGTTAAAAATCAAACATCCCTATTTTATAAGTTGAATTCCTTTTCATGTCTGAAGTTTATGAGCCTTTTTGATTGATCTACCAATTTAAATAACTCCTCCCACCACCCGTAACTTAGATAACCTTGTTGCATAAAGTTTATTTGCTTAATGTTCAGTGAATAAGTCAGTGTATGCGCTCAAAATAGTTTATCAAAGGACAACAGTGTCCTGGCTTAACTGGCTTAACATCTTTATTACTGAAGAAAGTCACCTACATCCTGGATGGCCTGAGGATGAAAGCAGCATTTATTTTTGGATGAACTTAAAGTTGAGTTTCTGAATGCTGTGGTAAACTTGAGTGTCTAAATGGTCTTATTTGTAGGGAGGATCCTTCAAGAGCGATGAGCCGCCACCATCA[C/T]AAACATCTGCCCCGAGCGCAGCAGCTGCTGCAGACGATGAGGAATGGGAATAACTGGCCTCACACCTGTTATATTTATTTTATTTTTATTTTATTTGTGCGAGCTTCTTCAATACCATTTCAGGATATTTGTTAATGTTGAATGACTAAAGTAGCATTAGGATAAAGCTGTTGTATTTAGAGTCACATTGAATGCTGTAGGTTTGACCTCAAGGACGATAATCAAGACTAATACCTTTTGGCAGTTTAATTTGATCATCTTTTTGGTATCACTCGTTTTGACTGGAGCACATCTGAAATAGTGGATTTGTTTTACTAGAGCACAAGTGCAGAAGTGGGTGGGTTTGTTTAATCACATTTTAACACTTTGCTAGGAGTGTATTGAGTTTTGTAAGCTTTGACCTAAAGGTGTTTCCTACAGTTAAATCTATTAATCAGTTCTATTGTTGATTGTGACTGTTTGTAGGTTATTTTTCTTGACATTTCCGTCTTGAAGCCAGA
Associated Phenotype:
Not determined