Busch Lab

ZMP

zgc:91849

Ensembl ID:
ENSDARG00000014323
ZFIN ID:
ZDB-GENE-040718-438
Description:
hypothetical protein LOC572021 [Source:RefSeq peptide;Acc:NP_001002687]
Human Orthologues:
CD101, IGSF3, IGSF8, PTGFRN
Human Descriptions:
CD101 molecule [Source:HGNC Symbol;Acc:5949]
immunoglobulin superfamily, member 3 [Source:HGNC Symbol;Acc:5950]
immunoglobulin superfamily, member 8 [Source:HGNC Symbol;Acc:17813]
prostaglandin F2 receptor negative regulator [Source:HGNC Symbol;Acc:9601]
Mouse Orthologues:
Cd101, Igsf3, Igsf8, Ptgfrn
Mouse Descriptions:
CD101 antigen Gene [Source:MGI Symbol;Acc:MGI:2685862]
immunoglobulin superfamily, member 3 Gene [Source:MGI Symbol;Acc:MGI:1926158]
immunoglobulin superfamily, member 8 Gene [Source:MGI Symbol;Acc:MGI:2154090]
prostaglandin F2 receptor negative regulator Gene [Source:MGI Symbol;Acc:MGI:1277114]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34532 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa7166 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34532
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002954 Essential Splice Site 23 986 None 11
ENSDART00000142964 Essential Splice Site 23 986 None 9
Genomic Location (Zv9):
Chromosome 9 (position 27710)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 456800
GRCz11 9 456433
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGCTGTGGCGCTTGTTTCTGCTGTGTCTCACAGGACTCCTGCGCTGGGG[T/C]GAGTCTCAATGTTTTTATTATATCGCGAAAATATATCTGATTTTTATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7166
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002954 Essential Splice Site 285 986 3 11
ENSDART00000142964 Essential Splice Site 285 986 3 9
Genomic Location (Zv9):
Chromosome 9 (position 30779)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 453731
GRCz11 9 453364
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGCRCACAAAACCTCTACAGCATGTGATGTGGAGATCAAACCAATCGG[T/C]GAGGTTTASATTTTMTAATTTAACCCAGGGGTTNNNNNCTAACCTAACCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2532
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002954 Nonsense 378 986 4 11
ENSDART00000142964 Nonsense 378 986 4 9
Genomic Location (Zv9):
Chromosome 9 (position 31137)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 453373
GRCz11 9 453006
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGCAGTGAAAACAAGTCTAACAGACTACCTGCTGACCATCCATTCAGCT[C/T]GAACTGAAGATCAGGGCCAATACCAGTGTGAAGTATGGCAGGAGAGCATG
Associated Phenotype:
Not determined