Busch Lab

ZMP

spaw

Ensembl ID:
ENSDARG00000014309
ZFIN ID:
ZDB-GENE-030219-1
Description:
southpaw [Source:RefSeq peptide;Acc:NP_851298]
Human Orthologue:
NODAL
Human Description:
nodal homolog (mouse) [Source:HGNC Symbol;Acc:7865]
Mouse Orthologue:
Nodal
Mouse Description:
nodal Gene [Source:MGI Symbol;Acc:MGI:97359]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9063 Nonsense Mutation detected in F1 DNA Not yet available
sa177 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9063
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003620 Nonsense 153 404 2 3
ENSDART00000139933 Nonsense 160 411 2 3
Genomic Location (Zv9):
Chromosome 5 (position 71787153)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68111771
GRCz11 5 68882438
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCATCAGCATAAACAGCRYTGTGCATCTGACTCCGTGTTTTGTCGCAAC[A/T]AAAAACTGTTTCTGGGCAGCGTTAAATCAGTAGACGTCTCYCAAKCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa177
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003620 Nonsense 275 404 2 3
ENSDART00000139933 Nonsense 282 411 2 3
Genomic Location (Zv9):
Chromosome 5 (position 71787519)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68112137
GRCz11 5 68882804
KASP Assay ID:
554-0047.1 (used for ordering genotyping assays)
KASP Sequence:
ACGTCACKCTGAACCGACCAGCAGATGGAACTCAGGGTCGGAGACACAAA[C/T]GAAACCGTGTGGAAAGGATGCGCATGACTGATGACAGAAATGTGACAGGA
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Control; 5 dpf
Control; 5 dpf
Mutant; 5 dpf
Mutant; 5 dpf
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
determination of left/right symmetry
GO:0007368
disrupted
PATO:0001507
abnormal
PATO:0000460