Busch Lab

ZMP

med15

Ensembl ID:
ENSDARG00000014292
ZFIN ID:
ZDB-GENE-040426-2032
Description:
Mediator of RNA polymerase II transcription subunit 15 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVN7]
Human Orthologue:
MED15
Human Description:
mediator complex subunit 15 [Source:HGNC Symbol;Acc:14248]
Mouse Orthologues:
A230006K03Rik, AC129019.1, AL606965.1, Glrp1, Med15
Mouse Descriptions:
RIKEN cDNA A230006K03 gene Gene [Source:MGI Symbol;Acc:MGI:3644205]
glutamine repeat protein 1 Gene [Source:MGI Symbol;Acc:MGI:108038]
mediator complex subunit 15 Gene [Source:MGI Symbol;Acc:MGI:2137379]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17487 Essential Splice Site Available for shipment Available now
sa23898 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17487
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021997 None 36 802 2 18
ENSDART00000139622 Essential Splice Site 23 48 2 6
ENSDART00000140129 None None 138 None 3
Genomic Location (Zv9):
Chromosome 21 (position 17760327)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18908579
GRCz11 21 18945215
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAAATTACAGTGAGGAAGCCATGAGAAAAGCAGGAACTGGTCACACAAA[G/A]TCCAGTACTGAGATGGAGAGCCATGTTTTTACGAAAGCAAAGACCAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23898
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021997 Essential Splice Site 69 802 3 18
ENSDART00000139622 Essential Splice Site None 48 3 6
ENSDART00000140129 None None 138 None 3
Genomic Location (Zv9):
Chromosome 21 (position 17760115)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18908367
GRCz11 21 18945003
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGTATTTATCAATGGTTGCGAGGCTGATAATTCACTTTAGAGACATCC[G/A]TAAGTAACCAACACAGATTTCAATATAAATGTTTTTGCATTGTTGTGTTT
Associated Phenotype:
Not determined