Busch Lab

ZMP

zgc:110805

Ensembl ID:
ENSDARG00000014289
ZFIN IDs:
ZDB-GENE-050306-30, ZDB-GENE-050306-30
Description:
Methyltransferase-like protein 10 [Source:UniProtKB/Swiss-Prot;Acc:Q5D013]
Human Orthologue:
METTL10
Human Description:
methyltransferase like 10 [Source:HGNC Symbol;Acc:33787]
Mouse Orthologue:
Mettl10
Mouse Description:
methyltransferase like 10 Gene [Source:MGI Symbol;Acc:MGI:1919346]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa36460 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36460
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007693 Nonsense 149 233 5 6
ENSDART00000126627 Nonsense 149 233 5 6
Genomic Location (Zv9):
Chromosome 17 (position 31907166)
Other Location(s):
Assembly Chromosome Position
GRCz11 17 31823223
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTCCTGAACCCCAGCACAGAATTGAAGGGTTTTGATGTATGTATTGAT[A/T]AAGGCACGTTTGATGCCATTAGTTTAAGCCCAGAGGACAGAGAAGAGGCA
Associated Phenotype:
Not determined