Busch Lab

ZMP

dlgap1

Ensembl ID:
ENSDARG00000014280
ZFIN ID:
ZDB-GENE-030616-580
Description:
Disks large-associated protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZYZ6]
Human Orthologue:
DLGAP1
Human Description:
discs, large (Drosophila) homolog-associated protein 1 [Source:HGNC Symbol;Acc:2905]
Mouse Orthologue:
Dlgap1
Mouse Description:
discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8937 Nonsense Mutation detected in F1 DNA Not yet available
sa6846 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8937
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008842 Nonsense 133 999 1 10
ENSDART00000131271 Nonsense 133 998 1 10
Genomic Location (Zv9):
Chromosome 2 (position 29325348)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29626983
GRCz11 2 29610516
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AMGGCTATYACACACTGCAGYACAAGCGTGCGGCWGCAGCCTTGGAGCAA[C/T]GAAGCGACAGTCCTGGCCGAATCCGGCACCTGGTGCACTCAGTTCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6846
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008842 Nonsense 888 999 9 10
ENSDART00000131271 Nonsense 888 998 9 10
Genomic Location (Zv9):
Chromosome 2 (position 29405541)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29707176
GRCz11 2 29690709
KASP Assay ID:
554-5177.1 (used for ordering genotyping assays)
KASP Sequence:
TAYTCCGCTTGGCTCAGCAGAACCCAAACGCTCACCCWCGGCCTGTGGCT[C/T]AGGATCTCGCWGGATTCTGGGACATGCTTCAACTTTCCATYGAGAACATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6013
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008842 Nonsense 915 999 9 10
ENSDART00000131271 Nonsense 915 998 9 10
Genomic Location (Zv9):
Chromosome 2 (position 29405622)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29707257
GRCz11 2 29690790
KASP Assay ID:
554-3843.1 (used for ordering genotyping assays)
KASP Sequence:
AACTTTCCATTGAGAACATCARCTTAAAGTTTGACGAGCTTCACCAGCTC[A/T]AAGCCAACAACTGGAGGCCCCTCGACCCCCCTGAGCGAAAGGTACAGCAA
Associated Phenotype:
Not determined