Busch Lab

ZMP

vox

Ensembl ID:
ENSDARG00000014277
ZFIN ID:
ZDB-GENE-010108-1
Description:
ventral homeobox [Source:RefSeq peptide;Acc:NP_571773]
Human Orthologue:
VENTX
Human Description:
VENT homeobox homolog (Xenopus laevis) [Source:HGNC Symbol;Acc:13639]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa11047 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11047
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008176 Essential Splice Site 160 242 2 3
Genomic Location (Zv9):
Chromosome 13 (position 54047989)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50308231
GRCz11 13 50623140
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGGAGAGAGAGTGAAAACTGCGCTGAAGCTCGGCCTGTCGGAAACACAG[G/A]TGAGATTCGCCTTTATTTGGCTTGCAGGTTGTTGCTAKAAGGGATACAGC
Associated Phenotype:
Not determined