Busch Lab

ZMP

eya1

Ensembl ID:
ENSDARG00000014259
ZFIN ID:
ZDB-GENE-990712-18
Description:
eyes absent homolog 1 [Source:RefSeq peptide;Acc:NP_571268]
Human Orthologue:
EYA1
Human Description:
eyes absent homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:3519]
Mouse Orthologue:
Eya1
Mouse Description:
eyes absent 1 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109344]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa3273 Essential Splice Site F2 line generated Not yet available
sa11723 Nonsense Available for shipment Available now
sa10957 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30063
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012253 Nonsense 51 587 3 17
ENSDART00000081595 Nonsense 73 609 4 19
ENSDART00000134221 Nonsense 51 592 3 17
ENSDART00000136443 Nonsense 73 609 4 18
ENSDART00000142058 Nonsense 51 86 3 4

The following transcripts of ENSDARG00000014259 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 13846273)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 13797721
GRCz11 24 13942140
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTGCTTACCTTCTGTTTGCAGTTAAAACAGAGCCAATGAGCAGCAGT[G/T]AAATCGCCACCTCTGTAGCAGACGGCTCTCTAGACAGCTTCTCAGGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3273
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012253 Essential Splice Site 139 587 5 17
ENSDART00000081595 Essential Splice Site 161 609 6 19
ENSDART00000134221 Essential Splice Site 139 592 5 17
ENSDART00000136443 Essential Splice Site 161 609 6 18
ENSDART00000142058 None None 86 None 4

The following transcripts of ENSDARG00000014259 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 13852962)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 13804410
GRCz11 24 13948829
KASP Assay ID:
554-3177.1 (used for ordering genotyping assays)
KASP Sequence:
TATGGCACATACCCTCAGCCAGGCCAGCCGTACGGGATTTCTGCCTATGG[T/C]AACCAATTCTTCCTAATGCRTTAAAGCTTTGCAATTTTGGTTGTGCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11723
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012253 Nonsense 344 587 10 17
ENSDART00000081595 Nonsense 366 609 11 19
ENSDART00000134221 Nonsense 349 592 10 17
ENSDART00000136443 Nonsense 366 609 11 18
ENSDART00000142058 None None 86 None 4

The following transcripts of ENSDARG00000014259 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 13875949)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 13827397
GRCz11 24 13971816
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAATCATCGTTTTCCATTCCTTGCTCACAGGATCTTACGYCAACCGATTC[G/T]GAAGGGTAAGTCGTGTATTTTAAATGCAAACACAGGYAAATATTGCGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10957
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012253 Nonsense 420 587 13 17
ENSDART00000081595 Nonsense 442 609 14 19
ENSDART00000134221 Nonsense 425 592 13 17
ENSDART00000136443 Nonsense 442 609 14 18
ENSDART00000142058 None None 86 None 4

The following transcripts of ENSDARG00000014259 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 13910278)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 13861726
GRCz11 24 14006145
KASP Assay ID:
2261-8534.1 (used for ordering genotyping assays)
KASP Sequence:
GATTCCACGCTGCTGCCACCAGTGCCAAYCTGTGTCTGGCCACCGGYGTA[C/T]GAGGAGGCGTGGACTGGATGAGAAAGCTCGCGTTCCGCTACAGACGAGTA
Associated Phenotype:
Not determined