Busch Lab

ZMP

rbmx

Ensembl ID:
ENSDARG00000014244
ZFIN ID:
ZDB-GENE-030131-579
Description:
heterogeneous nuclear ribonucleoprotein G [Source:RefSeq peptide;Acc:NP_997763]
Human Orthologues:
RBMX, RBMXL1, RBMXL2, RBMXL3, RBMY1A1, RBMY1B, RBMY1D, RBMY1E, RBMY1F, RBMY1J
Human Descriptions:
RNA binding motif protein, X-linked [Source:HGNC Symbol;Acc:9910]
RNA binding motif protein, X-linked-like 1 [Source:HGNC Symbol;Acc:25073]
RNA binding motif protein, X-linked-like 2 [Source:HGNC Symbol;Acc:17886]
RNA binding motif protein, X-linked-like 3 [Source:HGNC Symbol;Acc:26859]
RNA binding motif protein, Y-linked, family 1, member A1 [Source:HGNC Symbol;Acc:9912]
RNA binding motif protein, Y-linked, family 1, member B [Source:HGNC Symbol;Acc:23914]
RNA binding motif protein, Y-linked, family 1, member D [Source:HGNC Symbol;Acc:23915]
RNA binding motif protein, Y-linked, family 1, member E [Source:HGNC Symbol;Acc:23916]
RNA binding motif protein, Y-linked, family 1, member F [Source:HGNC Symbol;Acc:23974]
RNA binding motif protein, Y-linked, family 1, member J [Source:HGNC Symbol;Acc:23917]
Mouse Orthologues:
AC132601.1, AC163691.1, Gm10256, Gm10352, Rbmx, Rbmxl2, Rbmxrt, Rbmy1a1
Mouse Descriptions:
RNA binding motif protein, X chromosome Gene [Source:MGI Symbol;Acc:MGI:1343044]
RNA binding motif protein, X chromosome retrogene Gene [Source:MGI Symbol;Acc:MGI:1343045]
RNA binding motif protein, X-linked-like 2 Gene [Source:MGI Symbol;Acc:MGI:1923822]
RNA binding motif protein, Y chromosome, family 1, member A1 Gene [Source:MGI Symbol;Acc:MGI:104732]
predicted gene 10256 Gene [Source:MGI Symbol;Acc:MGI:3710530]
predicted gene 10352 Gene [Source:MGI Symbol;Acc:MGI:3708825]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22508 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28330
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007927 Nonsense 147 379 5 9
ENSDART00000128730 Nonsense 142 374 5 9
ENSDART00000131024 Nonsense 147 277 5 10

The following transcripts of ENSDARG00000014244 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 32730166)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31519973
GRCz11 14 31860287
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGCATGTCGTCCAGAGGGCCACCACCAATGAAAAGAGGCCCCCCAGAG[C/T]GAAACGGAGGACCCCCACCCAAGAGATCTGCACCTTCTGGGCCAATGGGC
Long Flanking Sequence:
GATCTAGTCCACAATTTCCTCTAAGAAGTTCTGAGCTTGCCTTGTGATTTATGTCTAGTTTCTTGTCAGTCTTTTTAACATTGGAGTAGTTTTCTAAACCTGTACTTTTTGTATTCAAGCCTCTTGATGGAAAGCCAATTAAAGTGGAGCAAGCCACAAAACCTCAGTTTGAGACTTCAGGACGCCGTGGGCCACCACCACCTCGCAGTCGTGGCCCTTCTAGAGGGCTGCGAGGGTCCAGAGGAGGCCCAAGTGGAATGCGGGGCCCACCAAGCAGAGGTACATTCAAATAACATTATCCAGTTATTTTAATTGTTGCTGTGATGACACATTCTTGATGATCTGTTTGAGTTGATTGTCCTCTAAGAAGTTCTGAGCCAACGCTTAACATCTATACTTGCTGAGAAAAATATTTCCAAGATAACGTAGGAATTGTAGAACCCTTTTTTAAAGGCATGTCGTCCAGAGGGCCACCACCAATGAAAAGAGGCCCCCCAGAG[C/T]GAAACGGAGGACCCCCACCCAAGAGATCTGCACCTTCTGGGCCAATGGGCAGACGTAAGTTTGGCTCTTTTTTTTTTTTTTTTTCCCCCCTCTCTCTCTCCTTATGGTAAAACTTTTGATCCATAAAATCCTTAATGTTAACATTTTGCACAGCGTCCAGAGACCGGGATCCATATGGCCCCCCTCCACGCAGAGATTCTCTTATGTCACGGCGGGATGATGGTCCTCCACATCGAGATGACCACTATGGTAGTAAAGACAGGTGAGATGTTTAAAAGCCCAACCTTATTCGTTGCTAAAGACTGTGTAATGCCAGCGCCAGACATCATATCGCCTAATTCATATCCAAAAAATTTGAGTGTAGCAATTAATGATGGCCTTTTTGTGTTCCTCCTCGACTTGAATTGTTTACTTGCTACGTCACTTCATTTGACACTAGCACTCTTATTTATTGCTGAATAACCATTCGGAGCACTCTTCAGCCAGTGCTGAATCAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22508
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007927 Nonsense 172 379 6 9
ENSDART00000128730 Nonsense 167 374 6 9
ENSDART00000131024 Nonsense 172 277 6 10

The following transcripts of ENSDARG00000014244 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 32729990)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31519797
GRCz11 14 31860111
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATCCTTAATGTTAACATTTTGCACAGCGTCCAGAGACCGGGATCCATA[T/A]GGCCCCCCTCCACGCAGAGATTCTCTTATGTCACGGCGGGATGATGGTCC
Long Flanking Sequence:
TCAGGACGCCGTGGGCCACCACCACCTCGCAGTCGTGGCCCTTCTAGAGGGCTGCGAGGGTCCAGAGGAGGCCCAAGTGGAATGCGGGGCCCACCAAGCAGAGGTACATTCAAATAACATTATCCAGTTATTTTAATTGTTGCTGTGATGACACATTCTTGATGATCTGTTTGAGTTGATTGTCCTCTAAGAAGTTCTGAGCCAACGCTTAACATCTATACTTGCTGAGAAAAATATTTCCAAGATAACGTAGGAATTGTAGAACCCTTTTTTAAAGGCATGTCGTCCAGAGGGCCACCACCAATGAAAAGAGGCCCCCCAGAGCGAAACGGAGGACCCCCACCCAAGAGATCTGCACCTTCTGGGCCAATGGGCAGACGTAAGTTTGGCTCTTTTTTTTTTTTTTTTTCCCCCCTCTCTCTCTCCTTATGGTAAAACTTTTGATCCATAAAATCCTTAATGTTAACATTTTGCACAGCGTCCAGAGACCGGGATCCATA[T/A]GGCCCCCCTCCACGCAGAGATTCTCTTATGTCACGGCGGGATGATGGTCCTCCACATCGAGATGACCACTATGGTAGTAAAGACAGGTGAGATGTTTAAAAGCCCAACCTTATTCGTTGCTAAAGACTGTGTAATGCCAGCGCCAGACATCATATCGCCTAATTCATATCCAAAAAATTTGAGTGTAGCAATTAATGATGGCCTTTTTGTGTTCCTCCTCGACTTGAATTGTTTACTTGCTACGTCACTTCATTTGACACTAGCACTCTTATTTATTGCTGAATAACCATTCGGAGCACTCTTCAGCCAGTGCTGAATCAGGTCAATGAGAGCTGATGTGTGGAACATGCCAAACCAACTAGTCTGACTAAAAAACCTAATAGTTGACCGTCTGCTTGTTGTGTCCTGGCATTAAGGTTGTCATTTGGATCCACAAAAATGACACTTCTGTATTATTCTGTCCAGTCTAGTAGTTGGCCATATCACTTGGTGTATTTCTT
Associated Phenotype:
Not determined