Busch Lab

ZMP

si:dkey-121j17.5

Ensembl ID:
ENSDARG00000014232
ZFIN ID:
ZDB-GENE-030131-4745
Description:
Novel protein similar to vertebrate protein kinase, cGMP-dependent, type I (PRKG1) [Source:UniProtKB
Human Orthologues:
PRKG1, PRKG2
Human Descriptions:
protein kinase, cGMP-dependent, type I [Source:HGNC Symbol;Acc:9414]
protein kinase, cGMP-dependent, type II [Source:HGNC Symbol;Acc:9416]
Mouse Orthologues:
Prkg1, Prkg2
Mouse Descriptions:
protein kinase, cGMP-dependent, type I Gene [Source:MGI Symbol;Acc:MGI:108174]
protein kinase, cGMP-dependent, type II Gene [Source:MGI Symbol;Acc:MGI:108173]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa10460 Nonsense Available for shipment Available now
sa16085 Nonsense Available for shipment Available now
sa5945 Nonsense Mutation detected in F1 DNA Not yet available
sa16040 Nonsense Available for shipment Available now
sa44929 Nonsense Mutation detected in F1 DNA Not yet available
sa13353 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10460
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017857 Nonsense 72 571 2 17
Genomic Location (Zv9):
Chromosome 20 (position 656109)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 649384
GRCz11 20 639231
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTAGCGGGRGAGCTGAAGGTTACTCAGGCTGGWCGTGATTTGCGTATTT[T/A]GAGCCYTGGAGATATGTTCGGGGAACTGGCCATTCTATACAACTGCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16085
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017857 Nonsense 106 571 3 17
Genomic Location (Zv9):
Chromosome 20 (position 655918)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 649193
GRCz11 20 639040
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAACTGTTTTCCCCMCAGCCATYTCTGCGGTAAAGTTATGGYGTATYGWG[A/T]GACAAACGTAWCGGAGCATCATGACCAACWAATCCAAGWTGAAACGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5945
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017857 Nonsense 109 571 3 17
Genomic Location (Zv9):
Chromosome 20 (position 655907)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 649182
GRCz11 20 639029
KASP Assay ID:
554-3878.1 (used for ordering genotyping assays)
KASP Sequence:
CCCACAGCCATCTCTGCGGTAAAGTTATGGTGTATCGAGAGACAAACGTA[T/A]CGGAGCATCATGACCAACAAATCCAAGATGAAACGAGAGCAGCTGATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16040
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017857 Nonsense 116 571 3 17
Genomic Location (Zv9):
Chromosome 20 (position 655888)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 649163
GRCz11 20 639010
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NNNNNNNNGATGGYGTATYGWGWGACAAACGTAWCGGAGCATCATGACCAAC[A/T]AATCCAAGWTGAAACGAGAGCAGCTGATGGGCTTCCTGAAAACGTACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44929
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017857 Nonsense 314 571 10 17
Genomic Location (Zv9):
Chromosome 20 (position 641408)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 634683
GRCz11 20 624530
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAGCATGTTGTTGCGAAGAAGCAGGAGGCTCACATTCTGCTGGAAAAG[A/T]AAATTCTCCAGGCTATCCGATGCGATTTCATTGTCAGGTCTGTGTAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13353
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017857 Nonsense 555 571 17 17
Genomic Location (Zv9):
Chromosome 20 (position 633682)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 626957
GRCz11 20 616804
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTTTCGGTTTTCAGGGTCCTTGCTATWTMAACTTCGACCGYTTTCCTTA[T/G]GACAAGACCCAGGCGGAGGAGGAATTCTCAGGCTGGGATTGTGACTTCTG
Associated Phenotype:
Not determined