Busch Lab

ZMP

zgc:55413

Ensembl ID:
ENSDARG00000014208
ZFIN IDs:
ZDB-GENE-040426-2909, ZDB-GENE-040426-2909
Description:
hypothetical protein LOC406830 [Source:RefSeq peptide;Acc:NP_998674]
Human Orthologue:
PPT2
Human Description:
palmitoyl-protein thioesterase 2 [Source:HGNC Symbol;Acc:9326]
Mouse Orthologue:
Ppt2
Mouse Description:
palmitoyl-protein thioesterase 2 Gene [Source:MGI Symbol;Acc:MGI:1860075]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa35960 Nonsense Mutation detected in F1 DNA Not yet available
sa14512 Essential Splice Site Available for shipment Available now
sa19122 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44829 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35960
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037389 Nonsense 12 291 2 9
ENSDART00000099658 Nonsense 12 177 2 8
ENSDART00000128235 Nonsense 12 246 2 7
Genomic Location (Zv9):
Chromosome 15 (position 34409009)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35254785
GRCz11 15 35112754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAAGCAGTTGTGGCGATGGCTGATGGCTGCAGACCATGTGTTTTTATTT[T/A]GGTTGTTTTACTGCTGCTGCCCTCAGCCATCATGGCGTACAGACCAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14512
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037389 Essential Splice Site 50 291 2 9
ENSDART00000099658 Essential Splice Site 50 177 2 8
ENSDART00000128235 Essential Splice Site 50 246 2 7
Genomic Location (Zv9):
Chromosome 15 (position 34408892)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35254668
GRCz11 15 35112637
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTGGTGGACCTAAAGAGTTGACACCCTTTGTGAACTTCATTAAAGAGG[T/A]AAGGAATCTAATGTANNNNNNTGTATTTTGTTTCACGCATGTTATCGTNNATACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19122
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037389 Essential Splice Site 198 291 None 9
ENSDART00000099658 Essential Splice Site None 177 None 8
ENSDART00000128235 Essential Splice Site 198 246 None 7
Genomic Location (Zv9):
Chromosome 15 (position 34400850)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35246626
GRCz11 15 35104595
KASP Assay ID:
2260-8822.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTTTCTGGCCCCGCTGAATGGAGAAGTTGAACATGTCAACTCAACAGG[T/C]AACTAAGCTATTAATTTGCCTAAAATTATTCTGTTATTCATCAATTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44829
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037389 Essential Splice Site 226 291 7 9
ENSDART00000099658 None None 177 8 8
ENSDART00000128235 None 226 246 7 7
Genomic Location (Zv9):
Chromosome 15 (position 34400229)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35246005
GRCz11 15 35103974
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTGATTGGCGGACCAAATGATGGTGTTATCTTACCGTGGCAATCAAG[G/A]TCTCCACAAAAGCTCCCAAAATTAACCCGAGCCTCGTTCACACATTTAAC
Associated Phenotype:
Not determined