Busch Lab

ZMP

picalml

Ensembl ID:
ENSDARG00000014137
ZFIN ID:
ZDB-GENE-030131-6795
Description:
Novel protein similar to vertebrate phosphatidylinositol binding clathrin assembly protein (PICALM)
Human Orthologue:
PICALM
Human Description:
phosphatidylinositol binding clathrin assembly protein [Source:HGNC Symbol;Acc:15514]
Mouse Orthologue:
Picalm
Mouse Description:
phosphatidylinositol binding clathrin assembly protein Gene [Source:MGI Symbol;Acc:MGI:2385902]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa9760 Essential Splice Site Available for shipment Available now
sa2794 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa9760
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114888 Essential Splice Site 44 466 1 13
Genomic Location (Zv9):
Chromosome 15 (position 18733492)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19836118
GRCz11 15 19771850
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGGCGACAACGCACGAAATCATGGGCCCGAAAAAGAAACACTTGGATTG[T/A]GAGTATTGTGCGGTTTGGTGTGGATTTGCGATRACGGACGGGTGTACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2794
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114888 Essential Splice Site 415 466 12 13
Genomic Location (Zv9):
Chromosome 15 (position 18709284)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19811910
GRCz11 15 19747642
KASP Assay ID:
554-2745.1 (used for ordering genotyping assays)
KASP Sequence:
TTCCAGTCCAGCATGCAGCCGGGACCGTCTGTGGCCACGGCATGGGGAGG[T/C]AAACGCTCTCTTGCACGTTTCAGCCACTCAAGCATGCTGTAGTCTTCTCY
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28437
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114888 Missense 466 466 13 13
Genomic Location (Zv9):
Chromosome 15 (position 18709011)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19811637
GRCz11 15 19747369
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACGGTGTTAGTTTCTCCTCTAGGACGTCAGGTCATGAGATTTTCAGTG[G/A]TAAACACGCTTTAGTCTCTTTCTTCCATCACCACCCATCCATAGTTTTTT
Associated Phenotype:
Not determined