Busch Lab

ZMP

gspt1l

Ensembl ID:
ENSDARG00000014123
ZFIN ID:
ZDB-GENE-030131-4009
Description:
G1 to S phase transition 1, like [Source:RefSeq peptide;Acc:NP_942101]
Human Orthologues:
GSPT1, GSPT2
Human Descriptions:
G1 to S phase transition 1 [Source:HGNC Symbol;Acc:4621]
G1 to S phase transition 2 [Source:HGNC Symbol;Acc:4622]
Mouse Orthologues:
Gspt1, Gspt2
Mouse Descriptions:
G1 to S phase transition 1 Gene [Source:MGI Symbol;Acc:MGI:1316728]
G1 to S phase transition 2 Gene [Source:MGI Symbol;Acc:MGI:1316727]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40114 Nonsense Mutation detected in F1 DNA Not yet available
sa26115 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40114
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016780 Nonsense 182 577 5 14
ENSDART00000143755 None None 166 None 4
Genomic Location (Zv9):
Chromosome 3 (position 36537755)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36511349
GRCz11 3 36653207
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTAATTCCGGCTCTCCACTGCAGGTATTTAACAGGAATGGTGGACAAA[C/T]GAACTCTGGAGAAGTATGAGAGAGAGGCCAAGGAGAAGAACAGGGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26115
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016780 Essential Splice Site 199 577 5 14
ENSDART00000143755 None None 166 None 4
Genomic Location (Zv9):
Chromosome 3 (position 36537701)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36511403
GRCz11 3 36653261
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTGGAGAAGTATGAGAGAGAGGCCAAGGAGAAGAACAGGGAAACTTGG[T/G]AATTACTGAAGTTAATATATTATTTTACCTGAACTTCTGCTGGCGGTCAG
Associated Phenotype:
Not determined