Busch Lab

ZMP

fam184a

Ensembl ID:
ENSDARG00000014081
ZFIN ID:
ZDB-GENE-041014-214
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5SPS1]
Human Orthologue:
FAM184A
Human Description:
family with sequence similarity 184, member A [Source:HGNC Symbol;Acc:20991]
Mouse Orthologue:
Fam184a
Mouse Description:
family with sequence similarity 184, member A Gene [Source:MGI Symbol;Acc:MGI:1923156]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa17922 Nonsense Available for shipment Available now
sa43511 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13959 Nonsense Available for shipment Available now
sa12300 Essential Splice Site Available for shipment Available now
sa32314 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17922
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005258 Nonsense 22 1051 1 18
ENSDART00000135715 None None 1085 None 18
ENSDART00000138686 None None 1036 None 17
Genomic Location (Zv9):
Chromosome 20 (position 41581531)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 41652690
GRCz11 20 41549800
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCTGGCAGCACTATTACAACCCCGCTGGCAGCGCWTCGACGGGGAAATA[T/G]AACAGCACCTCCACTTCAACATCCACCAGCACGTCCTTCCCRTCCGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43511
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005258 Essential Splice Site 345 1051 3 18
ENSDART00000135715 Essential Splice Site 285 1085 2 18
ENSDART00000138686 Essential Splice Site 285 1036 2 17
Genomic Location (Zv9):
Chromosome 20 (position 41675529)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 41746688
GRCz11 20 41643798
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCCACAAACTACAGGCCTCCCTCATGACTGCTGAGAACAACATAAAGG[T/A]AAGGAAACAACACTTTCATTTGTTCTAGAATTAAACTATAGAGGTTACAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29435
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005258 Nonsense 435 1051 5 18
ENSDART00000135715 Nonsense 375 1085 4 18
ENSDART00000138686 Nonsense 375 1036 4 17
Genomic Location (Zv9):
Chromosome 20 (position 41687313)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 41758472
GRCz11 20 41655582
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACAAGGTGTTGCGTCTGGAGGAGGAGAGAGGAGCGCTGCAGAACAAATG[T/A]CAGACGCTGGACGACCGGCAGAGACAGCAGATCGTCACACTGGAGAAGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19241
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005258 Nonsense 442 1051 5 18
ENSDART00000135715 Nonsense 382 1085 4 18
ENSDART00000138686 Nonsense 382 1036 4 17
Genomic Location (Zv9):
Chromosome 20 (position 41687332)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 41758491
GRCz11 20 41655601
KASP Assay ID:
2261-4800.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGGAGAGAGGAGCGCTGCAGAACAAATGTCAGACGCTGGACGACCGG[C/T]AGAGACAGCAGATCGTCACACTGGAGAAGGTATGAATCCATATGCTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13959
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005258 Nonsense 744 1051 11 18
ENSDART00000135715 Nonsense 684 1085 10 18
ENSDART00000138686 Nonsense 684 1036 10 17
Genomic Location (Zv9):
Chromosome 20 (position 41736649)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 41807808
GRCz11 20 41704918
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGAGCGGGAACACCTGGGCCAGCAGCTGGAGGAGATGGAGATGGAGCAC[C/T]AGCACAGACAGCAGCGGCTRCAGGAGGCTCACTGCTGYGCCATACAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12300
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005258 Essential Splice Site 822 1051 13 18
ENSDART00000135715 Essential Splice Site 762 1085 12 18
ENSDART00000138686 Essential Splice Site 762 1036 12 17
Genomic Location (Zv9):
Chromosome 20 (position 41766012)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 41837171
GRCz11 20 41734281
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAATAGTCTTGTTTGTCATTTTTCTCTGTCTCTCTCTTTTTCTMGTCTTC[A/C]GCGTCGCTTCGTTCTGAGCTCWACCATCTCCACGCATCAGCCATTGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32314
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005258 Essential Splice Site 975 1051 15 18
ENSDART00000135715 Essential Splice Site 915 1085 14 18
ENSDART00000138686 None None 1036 None 17
Genomic Location (Zv9):
Chromosome 20 (position 41796888)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 41868047
GRCz11 20 41765157
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAAGCCCAGGAGCTGCTGAAGGACAAGATCTCCGCTCTTCAGATCCTG[T/C]GAGTACATGCAAAACAGTTTGTATAAGATATACAGCATGTGCATTTTGAA
Associated Phenotype:
Not determined