Busch Lab

ZMP

abcc2

Ensembl ID:
ENSDARG00000014031
ZFIN ID:
ZDB-GENE-040426-1523
Description:
canalicular multispecific organic anion transporter 1 [Source:RefSeq peptide;Acc:NP_956883]
Human Orthologue:
ABCC2
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 2 [Source:HGNC Symbol;Acc:53]
Mouse Orthologue:
Abcc2
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 2 Gene [Source:MGI Symbol;Acc:MGI:1352447]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa22191 Nonsense Available for shipment Available now
sa6282 Nonsense Mutation detected in F1 DNA Not yet available
sa11900 Essential Splice Site Available for shipment Available now
sa2688 Essential Splice Site Available for shipment Available now
sa19049 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22191
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016604 Nonsense 273 1553 6 31
ENSDART00000114538 Nonsense 277 1564 6 34
Genomic Location (Zv9):
Chromosome 13 (position 556851)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 554834
GRCz11 13 685125
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTACAGAAGAAGAAAAGCAAGAAACGCAAGACCGTAGATGCTGAGGGT[C/T]AGAACGGACTGGCCAAAGGGGTCAGTCAGGACGTGCTGGTCATGGTGAGA
Long Flanking Sequence:
AGTTTATTGTCTAATGTTTTACTCATTTGAATATGCTGATTACTTGATTCTGATTGGCTGATGAGCATTCTATGCACTGCAAATTGTCTAATTTCTAGTGCAAATATCTAAAACCTCTTAAATCAAGAAGTATTTCTAGTCAAGCACAAAATATAGTTTTATTTTCAGAAATAATGAGTCAAAATGAACTGAGCTTTACATTAAAACAAGCAAAATAATCTGACAATGATGTAAAAATGATCATCTCATGTCAAAAGGAAGAACCAGATTATTGTGCATGGAAACCCAGTCATTGAGTGTGTTTGTGCTCCTCCAGCATGGTGTGGAAGGGCTTTAAAAGGCCTCTGGTTCAGGAGGACATGTGGGATCTGAACAAAAACGACTCCACACACTTCATCTGTCAGACGTTCGAGGACGTGATGGCCAAGGAGCTGAAGAAAGCCCGCAACAACCTACAGAAGAAGAAAAGCAAGAAACGCAAGACCGTAGATGCTGAGGGT[C/T]AGAACGGACTGGCCAAAGGGGTCAGTCAGGACGTGCTGGTCATGGTGAGAGAAAACACACACAATAATGCTGTTCTCAGATAAACTGTTAAATTCATATCCGCTCAGATCAATGTTTAGTTGGCTAATAGTTTAGTTTTGTGGCCAGTTGTCATGTAATAAACAGCAAACTGCAAAAAAAGCTAGTTCATGATGTGTAAAAGTGTCAAAAGGTGGATTTCTCTGCTGAATCAGCTGTTGATCTGCTCAAATAAGCCTCATCTAGAGGACTTTGCCTTTCATATAAGACACTGTTGATACCAAATCATCAACTAGAAGAACAGTTATTATTTGCCGTTCCTAAAACTTGAAGAGGCCACAAGACTTTTATCAGATAGTGTAGAGTTTTTGCCTTATTTCTAGTCCAAATATTTTTAAAAAATCTTAAATCAAGAAGCTTTTTCTAGACAAGTATTAAATATTGTCTTGTTTTCAGAAATAGTAGATCAAAATGAAGTGAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3859
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016604 Nonsense 527 1553 11 31
ENSDART00000114538 Nonsense 535 1564 13 34
Genomic Location (Zv9):
Chromosome 13 (position 564422)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 562405
GRCz11 13 692696
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTGATGATGTTGTAGATCCTGAAGTATTAYGCCTGGGAAACATCCTTC[G/T]AGGCTCAGGTTCAGGAGATTCGGGAAAAAGAGCTGAAGGTGATGAGGAAA
Long Flanking Sequence:
TAAGGGTTAGTAAAGTTTAGAGACATGTTTATGGTACGTGCAGATTTAAGTGTTAGTTGAGGATTTGGTTTAGGTGTACTGGCAGGTTTAATGGTTGGTTAAGGTTAGGGACTGGTTTAATAGTATGATTAGTGTTGGTTAATGTAATGGACAGGTGTAGTGGAATGGGTAGGTTAGGGACTGAGGTATTGGTTATGGGTTAAGAATTGTTTTAATGGTATGATTAGATTTAAGTGTTGATTAAGGTGTCCGTGTGTTCATGTGTGTCCATGTGATGATTATTATTCAGTAACACCAACATGTTTCCTTTCAGATGCAAAACATGAAATTTAAAGACTCTCGCATGAAAATAGTGAACGACCTGCTGAATGGAATTAAAGTAAGTGTGTTTAAACCCTCCTCTATTAGTGTTCTTCATCTTCAGTTCAGTCAGATGAACTGGTGCTTGTGTTTTGATGATGTTGTAGATCCTGAAGTATTACGCCTGGGAAACATCCTTC[G/T]AGGCTCAGGTTCAGGAGATTCGGGAAAAAGAGCTGAAGGTGATGAGGAAATTCGCCTACCTGTCCTCCGTCTCCACGTTCATCTTCTCATGCGCTCCAGCTCTCGTGAGTATAATGATGTCTTACAGCATTAAAGGACTTTATATTGTAAGACACCCGTGTGTTATGGCTAGTGTTGGGGGTAATTAGTTATAAAGTAACTCATTTCTGTAAATAAATTGCAGTGCTATTAAAAAGTCAGGGATTGCTTTTCATTTACAGGTAAATTAATTACAGTTGCTTACAATCTTTTTTTGCTTCTTTAAAGAAAAAATTGCTTAGATTCGACTCATTATTTCTGAAATGAAGACACTATTTTGTGCTCGTCTTGAAAATGCTTCTTGATTTAGGAGTTTTTAGATATTTGGACTAGAAACAGGATGAAAACTCTAAATCAGAAGAGCAGTGTATATTGAGAGAAGTGTGATCTGTAGTGTTGTTGAAGTGTGTTATTGTTGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6282
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016604 Nonsense 832 1553 18 31
ENSDART00000114538 Nonsense 840 1564 20 34
Genomic Location (Zv9):
Chromosome 13 (position 573208)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 571191
GRCz11 13 701482
KASP Assay ID:
554-5069.1 (used for ordering genotyping assays)
KASP Sequence:
TCTCTGCAGACTCGYATCTTGGTAACTCATGGAATCAGCTTCTTGCCGTA[T/A]GTAGATGAGATTGTAGTGTTGGTGCATGGCGTCGTGTCTGAGATCGGATC
Long Flanking Sequence:
CAATTTTTAGATTTTTGGATTAAAAACAAGACAAAGCTAGTAAGAAAAGTAAAATAAAGAACTGTTTAGTTATTATTACTGTATAATTTTACATTACTTTGAAGGTTGAATTTGGGGTTGGGGTTGGGGTAAGGGTTCGGCTGCAGCTGTATCCCTTCTAGCAACAACCAATGTTTCTATAGGGAATTAATGCAGGATCCATATATAACCCAATCTCGGCTTTCCTTTAGACTCTTCATTAGTTCTTTATACAGTAATGAATGGTTGAGTTATTTGTTTACTTAATCATCTGTGATATTAATTAACAATACATGCATATTAAAAGCATGTGTTGTAATTCTGACCAGCTTCTGGAGTGTAAACTGATCTCTGCAGCACACTGTATTCCAGCATTCCTCTTCAGTGGTAATGTTATATTGAGTCAAATATTTTGCTCTCCTATTCTCTCCGTCTCTGCAGACTCGCATCTTGGTAACTCATGGAATCAGCTTCTTGCCGTA[T/A]GTAGATGAGATTGTAGTGTTGGTGCATGGCGTCGTGTCTGAGATCGGATCATACGAAAGTCTTCGAGCCAGTAAAGGAGCTTTCTCTGAGTTTCTGGAGACGTACGGCAAAGACGAGAGCAACAAAGACAATGACAAAAAAGGTGTGCATCTTCCACCTGAGCTTCAAATATTGTCCTCCTGATGTTTAAAATGTAAATCTGAAGTTGAAGACTGTGTGCTTCAGCTGCTGACATGTGGAAGAAATGCATTAGACAAGAAACCCTAATCTGATGGCTTCTACAGTGTGTAATGAGTGTGCTCTCTTGATGAAACAGCAGCAGCAGCTCAGACACCAGTGTATGAAGAGATTGAGACGCTGCCGGAGGGCTTGGAGACGCAGGCTGATGGATCTCCAGAAGACATTGTTTCCAGTACATTAAAGAGAGAAAACAGTCTGCGCCACAGCCAGCGGCACTCCAAGAGGAACGGAAGGTATGAACAGTTAGATATTTCTGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11900
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016604 Essential Splice Site 1142 1553 23 31
ENSDART00000114538 Essential Splice Site 1152 1564 25 34
Genomic Location (Zv9):
Chromosome 13 (position 577918)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 575901
GRCz11 13 706192
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTMACTGCGGTTGTTGTACCGATGGCTGTTGTCTACTACTTTGTGCAG[G/T]TAACACAGATACCAGTAYTRACGAAAACTGTNNNTATATCAGTGGTGGACAGT
Long Flanking Sequence:
GTGCTCTAGGCTAGTTTATAACAACAGATGGTGCTCTAGGCTAGTTTATAACAACAGATGGTGCTCTAGGCTAGTTTATAACAACAGATGGTGCTCTAGGCTAGTTTATAACAACAGATGGTGCTCTAGTCTAGTTTATAACAGCAGATGGCGCTCTAGGCTGGTTTATAACAGCAGATGGCGCTCTAGGCTAGTTTATAACAGCAGATGGCGCTCTAGGCTAGTTTATAACAGCAGATGGCTTAGAATAGCTTTTAACAACAAACATTGCTCTAGGATAGTTTATAACTAGTTTATAAGTAAATATTTAAAACTTCCTAAACTGAAATGTGTCTTGAATGCAGGATATATTCACTGTGGACGAGATGATCCCGATGTCCTTCAGGTCCTGGATCCTCTGTCTTCTTGGAGTTCTGGGAACTCTTTTCGTCATCTGTCTGGCTACTCCAATCTTCACTGCGGTTGTTGTACCGATGGCTGTTGTCTACTACTTTGTGCAG[G/T]TAACACAGATACCAGTATTGACGAAAACTGTTATATCAGTGGTGGACAGTGAATATATATTTCATTAAAACAAGCTAAATAGTTTGCTAATGGAGTCAGAAATGTAGTATTATTTCAAAGTGAAAACTAGATTATTTTGCTTAGCCCGTTGTCAGTTTATTCTGCTTGTTTTAAGGGAAAACTAATTTTGCCTCATTATTTCTAAACACAAGATTATACATTTAACCTGTCCAGAACATGCTTCTTGGTTTAAGATTTTTTTAGATATTTAGACTAGAAACATGATAAAACCTCAATGAGAAATGGTTTGAAATCAAATAAATTCTTCTTGTGTTGTAGAGGTTTTACGTGGCCACGTCTCGGCAGCTCAGACGACTGGACTCGGTGTCTCGATCTCCCATATACTCACACTTTGGAGAAACCGTATCCGGCCTGTCCGTGATAAGGGCGTATGGACACCAGGACCGCTTCCTAAAGCACAACGAGCACACCATCGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2688
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016604 Essential Splice Site 1251 1553 25 31
ENSDART00000114538 Essential Splice Site 1261 1564 27 34
Genomic Location (Zv9):
Chromosome 13 (position 578886)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 576869
GRCz11 13 707160
KASP Assay ID:
554-2727.1 (used for ordering genotyping assays)
KASP Sequence:
ACTCTCTGAACAGCGGACTGGTCGGACTGTCCATCTCATACGCTTTAAAT[G/A]TAAATGCTTAAATCTGATGTATTTATGACAGTCAGCTGAAAGATCTTCCT
Long Flanking Sequence:
CTTCCTAAAGCACAACGAGCACACCATCGACCAGAACCTGAAGAGTGTTTATCCATGGATTGTTTCCAATAGGTCAGAATTAGTACTGCAATCATTAAAGATAACCTATTATGCAAAAACCCACTGTTATAAGGGGTATAAGTGTGTGAATATCTCCAGCCTCTAATGCTCATTATTTCCTTTTTAAAATTGTATTTATCTCCAGTTTTAGAGTATCCTCTAATCTTCCCTCAGCATGTTTGACGGTCCGCTGTAAAAGTGCATTTCCCTCTGTTGTAGAGTTTGCAGTGTGGCTGTGCACTTGAATTTTTCACTTTCACTTTGCTTTTCTCTGTCAGAATAGCTGAATCTGGAGTGTGTTTGTTGTTTGCAGGTGGTTGGCCATGCGTTTGGAGTCTCTGGGGAATCTGGTGGTGTTTTTCGCAGCTCTGTTTGCTGTCATCTCCCGAGACTCTCTGAACAGCGGACTGGTCGGACTGTCCATCTCATACGCTTTAAAT[G/A]TAAATGCTTAAATCTGATGTATTTATGACAGTCAGCTGAAAGATCTTCCTATTAAGTAGCATATCTGTGTCTTTATTAGGTGACGCAGACGCTGAACTGGCTGGTGAGAATGACGTCTGAACTGGAGACCAACATCGTAGCTGTGGAAAGAGTGAGAGAGTATGCCGAGATCCAAAATGAGGTGCAGTTTTACATTCATTCATTTTCCTTCAGCATATTCTCTTATTCATCAGGGATCACCACAGTGAAATGAACCGCCAACTATTCCAGCATATGTTTTATGCAGCGGATGACCTTCCAGCTGCAATACAGTGCTGGGAAACACCCAAACACACTCATTCACACCCACACTCATACACTACAGCCAGTGTAGTTGATCAGTTCCCCTATAGCGCATGTGTTTGGACTGTGGGGGAAACCGGAGCACCCGGAGGAAACCCACGCCAACATGGGGAGAACATGCAAACTCCACACAGAAACACCAACTGACCCAGCCGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19049
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016604 Nonsense 1361 1553 28 31
ENSDART00000114538 Nonsense 1371 1564 30 34
Genomic Location (Zv9):
Chromosome 13 (position 580700)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 578683
GRCz11 13 708974
KASP Assay ID:
2260-5872.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCCAGCCTGACCAACTGCTTGTTCCGCATCGTTGAAGCTGCGGACGGT[C/T]GAATCCTCATCGATGATATCGACATTGCCACGCTGGGACTCCACGATCTG
Long Flanking Sequence:
TTTGACTAGAAATGAGACAAAAACTCTTAAGTATTGAAAACCTTTTCTGCAGTGTAGTTCTGTATCTGTTTCTATCCTAGTTGTATTTACCGTATTTCACAGTGAAAATGCAGGGTTAATTAAACATCGCTCATTTTTGTTGGTACACTGTTAACAGTGTTTGCATCTGACACAGTATTTAACTGTAATTTGAACGGTATGTTACCATATTTTAAAGTTGCATTGTGAAAGTTACTGTATGTTTCACAATAAAGATATACAATACTGTATGTATATATATATATATATATATAGAACAAGATACATGGTGCTGTAAATGTAAATACTGTATTTTTGCTGTAATTGATTTACAGTGAGTTGCTGTATAGATTCTACATGAAATTGTTAACAGTGTATTTATTTTATTAAACTGAACCCAGATTGGCATCGTGGGTCGCACTGGAGCAGGTAAATCCAGCCTGACCAACTGCTTGTTCCGCATCGTTGAAGCTGCGGACGGT[C/T]GAATCCTCATCGATGATATCGACATTGCCACGCTGGGACTCCACGATCTGCGCAGTCGACTGACCATCATTCCTCAGGTGCAGCAACATTAATAACACAGCAGATAATAAAGGTTTGAGGAGAGATTTTCTTTTGTATAGGGTTTACCAATCTGGGTTTATATTCACAAAACATTTGTCATGACCATTAAAGTCCTTGTCAAATGAAGCCAAGATTATAGAATGTTAGTATCAGGATGTTAGTTTTAAGCATATCTATAATCCAGTGTCTCCAAAACTGACAAAACTCACATTACAAAGATATAAACCTGATATAAACATCTAAAGCTTGCAGTTTGTCTCTACTTCTGGATTACATTTAGATTACCATTATAGTAATGTAATCTGACTACTTTTGGATTACATTTAGATTGCCATAATAGTAACATACGCTGACTATTTTTGGATTACATTTAGATTGCCATAATAGTAATGTAATCTGACTACTTTCGGATTACATTT
Associated Phenotype:
Not determined