Busch Lab

ZMP

ube2q2

Ensembl ID:
ENSDARG00000013990
ZFIN ID:
ZDB-GENE-040426-1919
Description:
ubiquitin-conjugating enzyme E2Q 2 [Source:RefSeq peptide;Acc:NP_998152]
Human Orthologues:
AC011295.5, UBE2Q2, UBE2Q2P2
Human Descriptions:
ubiquitin-conjugating enzyme E2Q family member 2 [Source:HGNC Symbol;Acc:19248]
ubiquitin-conjugating enzyme E2Q family member 2 pseudogene 2 [Source:HGNC Symbol;Acc:37440]
Mouse Orthologues:
E330021D16Rik, Ube2q2
Mouse Descriptions:
RIKEN cDNA E330021D16 gene Gene [Source:MGI Symbol;Acc:MGI:2141773]
ubiquitin-conjugating enzyme E2Q (putative) 2 Gene [Source:MGI Symbol;Acc:MGI:2388672]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15381 Nonsense Available for shipment Available now
sa30279 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15381
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016117 Nonsense 23 182 1 6
ENSDART00000124645 Nonsense 23 373 1 13
Genomic Location (Zv9):
Chromosome 25 (position 30453272)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29020633
GRCz11 25 29463640
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAAGGCCGAAKTAAAGTTCCTGGAGTCAATCTTTGACCCAAACCATGAG[C/T]GATTTCGAATAATCGACTGGAAGCMAGACGAACTGAGYTGCCAGTTTAAT
Long Flanking Sequence:
TTTTTATCTTTTTATTAATATTGTATCTTTGTAAATGTTCTTTCTTGCATAATAAAAATAAATGCATATTATTATTATGTGTTTTTTTATTTTTATATGTTGGATAATGCAAGAGGACTGTCATAGACAAGAATGAAGACGAAGAATGGTCAACCACACGTTCACAAAACACAATTGGCGTCCCAGTAGTCCACGCAGATCTCGATCACCCACTTCCCCTCTCTCGCATTATTTCTTGGCGGGCGTTGTTTTGTCGTCTCTCCGGCCTCCAGTTCGCCTCTCTCTCCCCGCCCCCTCTTTGTTGTTTCTCTCCTCCAGCCTCCCTCCGCCGCCGCGCGCTCACACACACGCACTCTCGCTGGATCAGCTGCGCGCTCGCGGTCTCCGTGCGTCCCTTCCCCCCGCGGCCTGGCTGCTGATGAGATGAGTGGAAGATGTCGGTGTCGGGGCTGAAGGCCGAATTAAAGTTCCTGGAGTCAATCTTTGACCCAAACCATGAG[C/T]GATTTCGAATAATCGACTGGAAGCCAGACGAACTGAGCTGCCAGTTTAATGTGACGGGAGAAAAGCTGCTGATTATTCACTGCAACATCACGGTAAGATCCACCAGCCCCGTGTGTAGGTTTACATGCGAACAAGGCAAGGCCGAGTGAAACAACACCACCCACAAGCCCCTGTTTGCTCGAATAAAGCCACGATAGTGCGAATAAAAGCATTTAGGGTGATCAGTGTTCAGTTTTATAATCAAAAAGATGTCAAAATCACTGCTAAACAAGCAGCGCGAGCTACGCTTAGCTTGCTGGTGTATTAGCTAACAAAGTTAACTGCGTTTGCTCTCGGTTTCACTTTGTTGGCTTAATAAAACCATCAGCTAATCGTCAACGTTATTTATTCTTGTGTACAGGAGATGGTTGACCAAGACCTGTGGATGTTTTGTATTCTGCGTCACTTTAAATTAGTTGTCATGTAATTAGCTTGTGTGCTAATTTGGCTTAGCTGGTAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30280
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016117 Nonsense 25 182 1 6
ENSDART00000124645 Nonsense 25 373 1 13
Genomic Location (Zv9):
Chromosome 25 (position 30453266)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29020627
GRCz11 25 29463634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGAATTAAAGTTCCTGGAGTCAATCTTTGACCCAAACCATGAGCGATTT[C/T]GAATAATCGACTGGAAGCCAGACGAACTGAGCTGCCAGTTTAATGTGACG
Long Flanking Sequence:
TCTTTTTATTAATATTGTATCTTTGTAAATGTTCTTTCTTGCATAATAAAAATAAATGCATATTATTATTATGTGTTTTTTTATTTTTATATGTTGGATAATGCAAGAGGACTGTCATAGACAAGAATGAAGACGAAGAATGGTCAACCACACGTTCACAAAACACAATTGGCGTCCCAGTAGTCCACGCAGATCTCGATCACCCACTTCCCCTCTCTCGCATTATTTCTTGGCGGGCGTTGTTTTGTCGTCTCTCCGGCCTCCAGTTCGCCTCTCTCTCCCCGCCCCCTCTTTGTTGTTTCTCTCCTCCAGCCTCCCTCCGCCGCCGCGCGCTCACACACACGCACTCTCGCTGGATCAGCTGCGCGCTCGCGGTCTCCGTGCGTCCCTTCCCCCCGCGGCCTGGCTGCTGATGAGATGAGTGGAAGATGTCGGTGTCGGGGCTGAAGGCCGAATTAAAGTTCCTGGAGTCAATCTTTGACCCAAACCATGAGCGATTT[C/T]GAATAATCGACTGGAAGCCAGACGAACTGAGCTGCCAGTTTAATGTGACGGGAGAAAAGCTGCTGATTATTCACTGCAACATCACGGTAAGATCCACCAGCCCCGTGTGTAGGTTTACATGCGAACAAGGCAAGGCCGAGTGAAACAACACCACCCACAAGCCCCTGTTTGCTCGAATAAAGCCACGATAGTGCGAATAAAAGCATTTAGGGTGATCAGTGTTCAGTTTTATAATCAAAAAGATGTCAAAATCACTGCTAAACAAGCAGCGCGAGCTACGCTTAGCTTGCTGGTGTATTAGCTAACAAAGTTAACTGCGTTTGCTCTCGGTTTCACTTTGTTGGCTTAATAAAACCATCAGCTAATCGTCAACGTTATTTATTCTTGTGTACAGGAGATGGTTGACCAAGACCTGTGGATGTTTTGTATTCTGCGTCACTTTAAATTAGTTGTCATGTAATTAGCTTGTGTGCTAATTTGGCTTAGCTGGTAGTTTAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30279
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016117 None None 182 None 6
ENSDART00000124645 Essential Splice Site 243 373 7 13
Genomic Location (Zv9):
Chromosome 25 (position 30427630)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28994991
GRCz11 25 29437998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGAGCTAGTAAACGATAGCCTGTATGAGTGGCATGTCAAGTTAAGGAC[G/A]TAAGTATGCTTATCATATAAGAAATAGCGTGTTGAATGATTACAGTTTGA
Long Flanking Sequence:
CTAAAGTTTGCCTAAATTTAATCCTAGAATATTCGATATTGAGTAGTTTTTCAGAAATCAATAAAATCCTGCTAGATTTGACTTCAAGCTGATTTGTTTACTGCAGTAACCAGGGAAACGCTGTTATACATATAGCGCCACCTGCTGGATTAGCATTTTTATATAGCATATGAATACTGTTTTAGTTTAGGATATACTGTTAATGTCGCAGATGAGGAAAAAGAGTCTTAAAAAAAACTAAAAGGTATTGAATTTCATTCTTTGGTTCCTGTATATACCCTGATTGATATTTTTCCACTCTTTAACCGTTGTCTAAAAAGTTAGGCACAGGGAACATTGGTGTGGTGTGAAATCTGTTGGCATGCGAATGAGTCTTAGTGAAAAGAATGTTTCAGGTTTGCATGATCTGTTTGTTTACATTATATTCTTTTGGTTCCAGGTATCTATTCAGTGGAGCTAGTAAACGATAGCCTGTATGAGTGGCATGTCAAGTTAAGGAC[G/A]TAAGTATGCTTATCATATAAGAAATAGCGTGTTGAATGATTACAGTTTGAGTCACTAATGTGTAAAATGACTCTGTTTGGTTTATAAGGGTTGATCCAGACAGTCCCTTACACAGCGACCTACAGGTTTTGAAGGAAAAAGAAGGAATGGACTACATTCTGCTCAATTTCTCTTATAAAGTGAGCATTGTTGTTATTTTTTTATTTTATTGTTTTTTTTTTTGGTGTACAAATGAAAAGAGATAACAATTGAATTTTGGTTTTCTTGTGATGGCAGGATAACTTTCCTTTTGATCCTCCCTTCGTACGGGTTGTGTCTCCTGTCCTGTCTGGAGGGTGAGCTTGAGAACTTTGCTGAACCTATCTTGTATAATTATTTCTATATTTAATGGTTGCATTTACTTTGGTGCGAATTTAATGGGAGCATAGTAATATTTTTGATGTTACATAAAATGTCTTGTTTTCATTGCACAAAATATGTAGTAAAATTATGTTTTAGTT
Associated Phenotype:
Not determined