Busch Lab

ZMP

anxa13

Ensembl ID:
ENSDARG00000013976
ZFIN ID:
ZDB-GENE-010406-1
Description:
annexin A13 [Source:RefSeq peptide;Acc:NP_571849]
Human Orthologue:
ANXA13
Human Description:
annexin A13 [Source:HGNC Symbol;Acc:536]
Mouse Orthologue:
Anxa13
Mouse Description:
annexin A13 Gene [Source:MGI Symbol;Acc:MGI:1917037]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3289
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013294 Essential Splice Site 62 316 3 11
ENSDART00000122608 Essential Splice Site 62 291 3 12
Genomic Location (Zv9):
Chromosome 24 (position 6456746)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6344038
GRCz11 24 6373367
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTCAGAGAATGGAGATCAAGCAAGCCTACTTTGAGAAATATGATGACG[T/C]GAGTATTCGGAAAAGCAGTTAATGAAAATAWACWGTGGAGATYAAAATTA
Long Flanking Sequence:
AGTTTTGTTTATTTGAACTTGTATAAATTAACTATTATTTTAAATTGTATATAATAATTAATAAAACAAATTCTGGGGTCTGAATAATTTTTGGTTTGACTAAGTATTTTACAATTATGACATTTGTAAGAATTCTGACTTTATATCTTCCTTTTCTTTTCAGCCAACAATTGTGCCTTATGAAGACTTTGATGTAATTGCGGACATTAAGGCAATCCGCAAAGCCTGCAAAGGTTTCGGTGAGACTCTTATGTGATTCTAAAATCCTAATAAGCATTCATTATGTCTGTCAATTACATCTCATTTGCAATTACAGTTTGACATTGTGTTATAGCTAGTCTGTTATTTGCATACTCTTTAAGTCACTAGAGTGTAATATTCTAACTTTCTATTTAATTTCCAAGGAACGGACGAGAAAGCCATCATAGACATCCTAGCCTATCGAAGTGCAGCTCAGAGAATGGAGATCAAGCAAGCCTACTTTGAGAAATATGATGACG[T/C]GAGTATTCGGAAAAGCAGTTAATGAAAATAAACAGTGGAGATCAAAATTACTGAGCAATCTACAACTTTGTAAACTTTAAGGTCACTGCTTAGACTTATTTAAAATTACTAACAGGATTAAAAGAGCAGTTTTCAAAGCATATGTTATGAGTTACATGTATTCTGAGGCACAGTATAAAAAGCTTAAGATATTTTTAAATGAGCACTAATCAATATTTGAAATGGGTAAATAAGCAAACTTTCAGATACCTGTATCTTGTGGTCCACAAGTTCACGTTAGTAAATAAAGCAATTTAAATATGCAAATATATTTGGGTCTTATCAGAAACATTGTATTTGTCATCATACTGGGAAAACCCTGAATTTTCAAAGAAGTGTGTACAGTAGTAGTCTGTGAGAGGTGGAGAGATGTCATGTTTTTGTAATGATGAGCCTACAGAGCTTCATGACAGAGTGAATGCAAATGTTTATCATAAGCTCCTTTGGCAACATGATATTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30037
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013294 Essential Splice Site 277 316 10 11
ENSDART00000122608 Essential Splice Site 277 291 10 12
Genomic Location (Zv9):
Chromosome 24 (position 6446832)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6334124
GRCz11 24 6363453
KASP Assay ID:
2261-8400.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGGAACCGATGAAGACACTCTCATCCGCATCATCGTGTGTCGCTCAGAG[G/A]TACACTATAACACCTATCCATATGGCATGTTGATGTTAACCTTTCAAGAC
Long Flanking Sequence:
TGTCACTGTTGGCAGGCATCGCTTCAGAGTATGTAGTAATCGTTGCGAATGCAACCAGGAAAATGGTCCGGGGGAAATTAGCAGTTCATTTAACTACCCATTGTGCAAGCTCCTAAAGATGGAGGCAACTGTAAGATGGCCACCGTGACTTTAACAGGGTGAGCAGGTGGCTATGTGAAAGTGAAACTCCCACAAATCCATATGTAAGGTCTTCTGCAAACAACCGAGGTTCACATCAATGACCTTATCATAGTAAATACCTCTAATATGTTGTTTTTAAATAACACCAAAAGAGGGTTTACCCTTACACAAGCTGTTAAATCCTATCCTATCACTAAATTGATTGGTAACTCTTCAGCACTAACAGGTTAACTCTTTAACCCATAGTGAGGTGTGCTAAGAACCCCCAGCTGTTCTTTGCCCGGAGGTTGAACGCCGCTATGAAAGGAGCCGGAACCGATGAAGACACTCTCATCCGCATCATCGTGTGTCGCTCAGAG[G/A]TACACTATAACACCTATCCATATGGCATGTTGATGTTAACCTTTCAAGACTTTTAAATGTGTTAAAGAAGTCTCTTATGTCCACCAAAACTATGCAATTTTGTAAAATATTATTACAATTTTAGTCCTTATGTACTGTTGGGGATGTTTTCATCCATTCTGGGGTCTTTGTGTCTTAATTTGAACAGTAAGCCTGTTGCAGAAAATTATTTAGTTGCATAATTACACCGATATCAAAGATTGCATTATACCATTTCCACAAAAAAGAGGGAAAAAAACTCCGCTTGACATTTTCTATCTTGGGCAGGTTGATCTGGAGACTATTAAAGACATGTACCTGGAGAAATACGACGTGACTCTGAAAGACGCCATCAGCTCTGAATGCGGAGGCGATTTCAAGCGCCTCCTGCTGGCCATCCTTCACTGAGAACAACATTCAGCCACTGGCGCTCCAGGCTTTAACTATAGTCACCATCAAGGCAAACTAACAAGACTTATTTT
Associated Phenotype:
Not determined