Busch Lab

ZMP

slc16a9a

Ensembl ID:
ENSDARG00000013926
ZFIN ID:
ZDB-GENE-040426-1364
Description:
solute carrier family 16 (monocarboxylic acid transporters), member 9a [Source:RefSeq peptide;Acc:N
Human Orthologue:
SLC16A9
Human Description:
solute carrier family 16, member 9 (monocarboxylic acid transporter 9) [Source:HGNC Symbol;Acc:23520
Mouse Orthologue:
Slc16a9
Mouse Description:
solute carrier family 16 (monocarboxylic acid transporters), member 9 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa36384 Nonsense Mutation detected in F1 DNA Not yet available
sa25039 Nonsense Mutation detected in F1 DNA Not yet available
sa42910 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa633
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020167 Nonsense 43 512 2 6
ENSDART00000125462 Nonsense 43 512 2 7
ENSDART00000131299 Nonsense 43 444 2 5

The following transcripts of ENSDARG00000013926 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 20496021)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20646032
GRCz11 17 20665868
KASP Assay ID:
554-0542.1 (used for ordering genotyping assays)
KASP Sequence:
TTTCTGTCTTTTGGATCCCCTCAATCTGTTGGGGTGTTGTATCCCGAGTG[G/A]CTCAGTGCCTTTCAGGAGGGAAAAGGCATGACAGCTTGGGTCGGTTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36384
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020167 Nonsense 203 512 5 6
ENSDART00000125462 Nonsense 203 512 5 7
ENSDART00000131299 Nonsense 203 444 5 5

The following transcripts of ENSDARG00000013926 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 20488176)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20638187
GRCz11 17 20658023
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGTGCTGGGCCAATGCGACCTTTGAACTTACCTGGCTACTACCTGAAA[C/T]AGAGAGCTGCTCTACAACGCACAGAGGACCCAGAACCACTCTATAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25039
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020167 Nonsense 405 512 5 6
ENSDART00000125462 Nonsense 405 512 5 7
ENSDART00000131299 Nonsense 405 444 5 5

The following transcripts of ENSDARG00000013926 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 20487568)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20637579
GRCz11 17 20657415
KASP Assay ID:
554-7858.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGGTCTACAGATTCTTTCAGCCTCTGTTGGGTTTTTCTCAGGGAACTG[G/A]TCTCTTACATCATACATCACTACCAAGATTGTGGGCATTGAACGGCTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42910
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020167 Nonsense 463 512 6 6
ENSDART00000125462 Nonsense 463 512 6 7
ENSDART00000131299 None None 444 None 5

The following transcripts of ENSDARG00000013926 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 20485316)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20635327
GRCz11 17 20655163
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCGACTGGACTCAGTCATATGACCTGGCGTTCTACCTCAGTGGCACTTG[T/A]GTTTTAGTGTCTGGTGTGTTTCTGTTCTTGGCTGCACTGCCTTGCTGGAA
Associated Phenotype:
Not determined