Busch Lab

ZMP

frya

Ensembl ID:
ENSDARG00000013921
ZFIN ID:
ZDB-GENE-060510-4
Human Orthologue:
FRY
Human Description:
furry homolog (Drosophila) [Source:HGNC Symbol;Acc:20367]
Mouse Orthologue:
Fry
Mouse Description:
furry homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443895]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa22679 Essential Splice Site Available for shipment Available now
sa13092 Essential Splice Site Available for shipment Available now
sa12657 Essential Splice Site Available for shipment Available now
sa35928 Nonsense Mutation detected in F1 DNA Not yet available
sa7409 Missense Mutation detected in F1 DNA Not yet available
sa22680 Nonsense Available for shipment Available now
sa15169 Essential Splice Site Available for shipment Available now
sa44826 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22681 Essential Splice Site Available for shipment Available now
sa39060 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14402 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22679
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 236 3024 8 62
Genomic Location (Zv9):
Chromosome 15 (position 31078646)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31974298
GRCz11 15 31832277
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCTGTGCTTCATCCCACACTCTTATTTTATTTGTTGTTTTCTTTTTGT[A/T]GATTTCCTGCTGTTAAAAAGAGGTTCACGAGTGAGTTGAAGGAGCTTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13092
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 390 3024 11 62
ENSDART00000045921 Essential Splice Site 390 3024 11 62
Genomic Location (Zv9):
Chromosome 15 (position 31079583)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31975235
GRCz11 15 31833214
KASP Assay ID:
2260-8723.1 (used for ordering genotyping assays)
KASP Sequence:
CCTYAATAGATGGCATGTCTTCCTCAACAACTGCCTCTCCAATCTAAAGG[T/C]ATGTGGTTTCACTGGTTATCTTTATTCATATGTGATTCTWCAAGAAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12657
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 390 3024 11 62
ENSDART00000045921 Essential Splice Site 390 3024 11 62
Genomic Location (Zv9):
Chromosome 15 (position 31079583)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31975235
GRCz11 15 31833214
KASP Assay ID:
2260-8723.1 (used for ordering genotyping assays)
KASP Sequence:
CCTYAATAGATGGCATGTCTTCCTCAACAACTGCCTCTCCAATCTAAAGG[T/C]ATGTGGTTTCACTGGTTATCTTTATTCATATGTGATTCTWCAAGAAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35928
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Nonsense 395 3024 12 62
Genomic Location (Zv9):
Chromosome 15 (position 31079680)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31975332
GRCz11 15 31833311
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTAAATGTGATAGCATACATTTGATCTGTTGTTACAGAGTAAGGACCCT[A/T]AAATGGCACGGGTAGCGCTAGAGTCCCTCTACAGACTTTTATGGGTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7409
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Missense 873 3024 21 62
Genomic Location (Zv9):
Chromosome 15 (position 31095265)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31990917
GRCz11 15 31848896
KASP Assay ID:
554-4177.1 (used for ordering genotyping assays)
KASP Sequence:
TGAGACAGGAGTACCTGCCTAAACACTGTCCCACAGCGCTCAGCTATGCC[T/A]GGCCCTACGCCTTCACCCGTCTGCAGCTCCTCATGCCTTTACTTGAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22680
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Nonsense 933 3024 22 62
Genomic Location (Zv9):
Chromosome 15 (position 31098433)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31994085
GRCz11 15 31852064
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGTGTTTTGGTGTGGCCAAACCAAGCATCATGAGCCCGGGTCATCTT[C/T]GAGCATCCACCCCTGAGATCATCACTCCCAGCCCAGACAGCAACAGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15169
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 1045 3024 26 62
Genomic Location (Zv9):
Chromosome 15 (position 31102213)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31997865
GRCz11 15 31855844
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAACTCACAGCCTGAGAARCAAGACATAACTCCGGTCTCTGTGTCTCTC[A/T]GCACAAATGGAGCCCTGGAACGYRATACACTGGCCCTGGGCGCKCTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44826
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 1103 3024 27 62
Genomic Location (Zv9):
Chromosome 15 (position 31103971)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31999623
GRCz11 15 31857602
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGACATCTAATTGTTCTTTTCCTCTTTCCTTGTTTTATTTATATCATA[G/A]TGCATCATCGGCGTTTCCTCTTCCCTCAGCAAAGTCTTCGGCACCACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22681
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 1527 3024 34 62
Genomic Location (Zv9):
Chromosome 15 (position 31113171)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32008823
GRCz11 15 31866802
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATTCTACCGATTTTCAGCCACAAGTAAAATTGTCACCACCTCTTCTGG[T/A]ATGCAAAGCCTTACTCAACATAAAGAAAAGTTGTGTGCGCGTTTAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39060
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 1669 3024 38 62
Genomic Location (Zv9):
Chromosome 15 (position 31119018)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32014670
GRCz11 15 31872649
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGGACTGGGCTCTTCATCTCCCTCTGCTGCTCCATGCCTGTTTTCTTG[G/A]TCAGTTGTGTTTTCAACACAATTTAGGCCATTTTTTCAGGGATTAGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14402
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Nonsense 2346 3024 49 62
Genomic Location (Zv9):
Chromosome 15 (position 31135366)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32031018
GRCz11 15 31888997
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGACGCCGGTGATTGGTCGACGGTATGATGAGCTTCACGGTTCTCCAAGA[C/T]AAGATGGKAAGAATCAAGGAGTGGTTACGGTGACACGCAGYACCTCCTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28492
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 2540 3024 54 62
Genomic Location (Zv9):
Chromosome 15 (position 31141514)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32037166
GRCz11 15 31895145
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTACTTACTATTCACTTAATGACTTCTTTCTGGGTTTTTTTTTTTTTC[A/G]GAATGTCAGCCTGTCTCCTACAGAGGATCTAAACCCCATGGATTCTCCTC
Associated Phenotype:
Not determined