Busch Lab

ZMP

SORL1

Ensembl ID:
ENSDARG00000013892
Description:
sortilin-related receptor, L(DLR class) A repeats-containing [Source:HGNC Symbol;Acc:11185]
Human Orthologue:
SORL1
Human Description:
sortilin-related receptor, L(DLR class) A repeats-containing [Source:HGNC Symbol;Acc:11185]
Mouse Orthologue:
Sorl1
Mouse Description:
sortilin-related receptor, LDLR class A repeats-containing Gene [Source:MGI Symbol;Acc:MGI:1202296]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa6374 Nonsense Mutation detected in F1 DNA Not yet available
sa6373 Nonsense Mutation detected in F1 DNA Not yet available
sa45536 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32030 Nonsense Available for shipment Available now
sa1275 Essential Splice Site Available for shipment Available now
sa22633 Nonsense Available for shipment Available now
sa774 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4602
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011416 Nonsense 291 2045 6 44
Genomic Location (Zv9):
Chromosome 15 (position 20584042)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21686668
GRCz11 15 21622400
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGACTCCAGCATCCTCACCAGCACAGACTTCTTCCAGAGCGAGCAAAAC[C/T]GACGCATTATCCTGGAGAAAGTGGACAGTTTCCAGCTACGTGACAAATAC
Long Flanking Sequence:
CATCAGCTTAAAATAAAAAAACTGTTGAATGTTAGTAAGTTGAGTTGTTCAATATAGTTACAGTAGTGATAACTCCTTGGCTTTTTAGCTAAAGTTTTTACAGCTTATTTATAGATGATATACATTGGTTTTAATGTTGTGATGTTTGTGTTGGACCAGCTTGTAGCGCAACAAGATAAATGAGGGAACATCATTGTGTTCATAAAAAGTTTAGCAGCAGCCGTAACTGATGCCTGATGCTTCTATAAATCCTCTGGCTTGCTTTAGCACCTTTGGAAACATTCTTAATGGGTTTTGTATTTAAATTAGAGTCAATAGTTACACACCTAAATATTTAAAATTATCAACATTATTTATTACTTCTCACAAATGTGTCTTTCTGTCCCCCTAGGGGTGTAGAGCCGTACGACAACCCCACCACAGTGTTTGTCCAGCGCCACGAGCCCCAGGGAGACTCCAGCATCCTCACCAGCACAGACTTCTTCCAGAGCGAGCAAAAC[C/T]GACGCATTATCCTGGAGAAAGTGGACAGTTTCCAGCTACGTGACAAATACATGTTTGCCACCACCACCAGGGTAAGGCTGCACTCCGACCAGACCAGGGGCACAAACCTTTGAAAGATCATTTGAAGATTAAGACTTTTATATAGCAAAAGAAGGGAAGAATAAAAAAACTCCTAGCTAAAAAAAAAATGTGGAGGGTGCTGAGAGGCAGATCTGTGCCAGCTCTAGCTGAATGCCTCTCCTGTGAGCATGAGTAAACACTCCTCTGAAGAGCTGAAGGAATCATCCTGCTCAAGATCAGCAGGCAGTGATAACAAGCTTATTTAAAGCTTTGGGTTTGGGTGAGGACGGTCCCTGGTGGGTTTATTTAGTGTTGAACTTCTGCCCTTTGTGGCAGAGGGGGTATTTCAGGTCACTAAATACTCGTTTATATAAGGGGTTTTACCATTTTGCTTTTTAAATTTTTTCATCATCAAAGCAAACATACTCATTAATCTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6374
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011416 Nonsense 323 2045 7 44
Genomic Location (Zv9):
Chromosome 15 (position 20561876)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21664502
GRCz11 15 21600234
KASP Assay ID:
554-4269.1 (used for ordering genotyping assays)
KASP Sequence:
AACTCGATGTRAACGTGTTTCCACAGGCATTATTGGGGAGCCACGAGTCT[C/T]AGTCTGTYCAGCYCTGGGTTTCTTACAACYGACAGCCAATGAGAGCAGCT
Long Flanking Sequence:
TTTTTCATAGTCCATTCATCATATTGTTCTTATTATATCAATGCTGAAATAAAACAATTAAAAATAAGTTTAATCACTTTTTTTATTGAAAAATTGCTCAATTATTATTATTATTATTATTATTATTTCATGTTCATTAAAAAGATTTTTACTTTTACGTGTTTATTTATTTGTTTTTACTCTGAGGATATGTTTGTTTTTAATTCATAAATTCTGTGTATTTTATTTTTAGGGGAAAGTTTGAAAATAATAAAACTAAGACAGTCAATAATTTGTCCTATGTTGTATTTTATACTACTATGTATGATCTTGTTTAACACCAATATAAAAATAAATAAATAAATTAGAACAAATATAAATATTTTAAAAATAGTTGTATTGTTATTTTATCTAAAAACATGACAAATTCTAATATTATATGGTATCAAGTTTGTTTTATTTATGATTGATAACTCGATGTAAACGTGTTTCCACAGGCATTATTGGGGAGCCACGAGTCT[C/T]AGTCTGTCCAGCTCTGGGTTTCTTACAACCGACAGCCAATGAGAGCAGCTCAGTTTAACACCCGTCACCCAATCACAGTAAGCTCCATCAGCTTCCTTTACTTTCCCATGGATTTATTCTTTTTAAAAGCTTCATTTTGTTTGCCTATATTTATGTTATTCTCTGCTTTTCTCTGTCTGCAGGAGTACTACATAGCAGACGCTTCAGAAGACCAGGTCTTTGTGTGTGTGAACCACAATAATAATGTCACACACCTGTATATCTCAGACACACAGGGCCTGTCCTTTTCCCTGTCCCTGGAGAATGTGCTGTACTTCAGCCCTGATGGATCAGGAAGCAACACTCTTATCAGGTACGTTTTAACACTGGTGTGTTTGTTTTGCAGGTCCATAGACACTAGCACAGCGAAGTGTATTTACCCAAACAGGACAGCCATATGTTGGTTTGGGAGCAACATTTGTGTTAAGCCATCATATCACTAACCCTATTCCTAAATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6373
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011416 Nonsense 333 2045 7 44
Genomic Location (Zv9):
Chromosome 15 (position 20561846)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21664472
GRCz11 15 21600204
KASP Assay ID:
554-4926.1 (used for ordering genotyping assays)
KASP Sequence:
TATTGGGGAGCCACGAGTCTYAGTCTGTYCAGCYCTGGGTTTCTTACAAC[C/T]GACAGCCAATGAGAGCAGCTCAGTTTAACACYCGTCACCCAATCACAGTA
Long Flanking Sequence:
TATTATATCAATGCTGAAATAAAACAATTAAAAATAAGTTTAATCACTTTTTTTATTGAAAAATTGCTCAATTATTATTATTATTATTATTATTATTTCATGTTCATTAAAAAGATTTTTACTTTTACGTGTTTATTTATTTGTTTTTACTCTGAGGATATGTTTGTTTTTAATTCATAAATTCTGTGTATTTTATTTTTAGGGGAAAGTTTGAAAATAATAAAACTAAGACAGTCAATAATTTGTCCTATGTTGTATTTTATACTACTATGTATGATCTTGTTTAACACCAATATAAAAATAAATAAATAAATTAGAACAAATATAAATATTTTAAAAATAGTTGTATTGTTATTTTATCTAAAAACATGACAAATTCTAATATTATATGGTATCAAGTTTGTTTTATTTATGATTGATAACTCGATGTAAACGTGTTTCCACAGGCATTATTGGGGAGCCACGAGTCTCAGTCTGTCCAGCTCTGGGTTTCTTACAAC[C/T]GACAGCCAATGAGAGCAGCTCAGTTTAACACCCGTCACCCAATCACAGTAAGCTCCATCAGCTTCCTTTACTTTCCCATGGATTTATTCTTTTTAAAAGCTTCATTTTGTTTGCCTATATTTATGTTATTCTCTGCTTTTCTCTGTCTGCAGGAGTACTACATAGCAGACGCTTCAGAAGACCAGGTCTTTGTGTGTGTGAACCACAATAATAATGTCACACACCTGTATATCTCAGACACACAGGGCCTGTCCTTTTCCCTGTCCCTGGAGAATGTGCTGTACTTCAGCCCTGATGGATCAGGAAGCAACACTCTTATCAGGTACGTTTTAACACTGGTGTGTTTGTTTTGCAGGTCCATAGACACTAGCACAGCGAAGTGTATTTACCCAAACAGGACAGCCATATGTTGGTTTGGGAGCAACATTTGTGTTAAGCCATCATATCACTAACCCTATTCCTAAATTTTTTTTTTGTTATTGTCTTCAATAGTTTTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45536
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011416 Essential Splice Site 1595 2045 34 44
Genomic Location (Zv9):
Chromosome 15 (position 20518718)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21621344
GRCz11 15 21557076
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCCTAAAAATATGCCTACATCCTCCTGTTCTTTTGTCATCTACTTCAGG[T/A]AAAGCAGGGACTGGATAAATCTATCCTTTTTTAATTTATATTTTTAAGTT
Long Flanking Sequence:
ATGAAAAGGGACATTTTATCTTCCTTTTAAGGATAAATATGAAAGTCTTAAAAATTAATTCAGAAAAAATTGCATTGTTACACTACCTTAAGCTTTACCTATTTTACTCTCCATTGTATTTCAGCCACTCATGGCCCTCTGCTCTGTGCGAATGGTACGCGGTGTGCAGACGGCGAGGCCTGTTTGCTGAACAGCGAGAGGTGTGATGGTTTTATAGACTGCTCTGACCGAAGTGACGAGCACAACTGCACTGGTGAGACACTGAGAGACGTTCATCACGTCTTTGCAGTGCTGGAAATCTGCTGCACTGGAGCACATTAAACTGACGGTCTGCCTGTTCATGCTGATTCACCCTGATTTTGCATTTCCCAGATGAACAGCAGGTCTACAAGGTTCAGAATCTACAGTGGACTGCCAATTTCTCTGGAGCTGTCAAGCTTACATGGACAAGGCCTAAAAATATGCCTACATCCTCCTGTTCTTTTGTCATCTACTTCAGG[T/A]AAAGCAGGGACTGGATAAATCTATCCTTTTTTAATTTATATTTTTAAGTTACATTTTAGTTGTCATTTTTCTTTCTTTTTATTTATTTATTTATTTCTATTTTCTTTTATTTATTTTATTTTATTTTATTTTTATTTAATTATATTTATATTTTTTATTTTTATTTCTTTTATTGTTTAGTTTTATCTATTTTTCTTTTTCTTTTTGTTTTTATTTTCTTTTATTTATTATTATTATTATTTTTTTTTTCCTTTTTTTTTTTTTTTTTTTTTGTCTATTTACTTTTTAATTTATTTTCTTTTTTATTTATTTTTATTTATTTTCTTTTGTTTTCATATCAATTTTATTTATTGTTTCCTCAATTTTATATATTTATATATATTTAATTTAATTGTATAATATTTTAAAATAATTTTTATAAATTATTTTACAATTTCTTTTAGTCTCTTTTTATTATTTCAGTTACATATATTTAGTTCTTAAGAATAGATTGCATATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32030
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011416 Nonsense 1721 2045 37 44
Genomic Location (Zv9):
Chromosome 15 (position 20515887)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21618513
GRCz11 15 21554245
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCACCAGCACTAACGCAGAAGTGAAGAACCTGCAGCCCAGCTCGCTCTA[C/A]AGATTTAGGGTGAGATGCTCTGAGATCCTGCATGCTGCTGTTTCATGTGC
Long Flanking Sequence:
TAATCAGACATTGAAACATTAATTTGTTTTGTTTTATTTTATTTTGTATAGGATTAAAAAACAAACACCAAAGTTTCTCTCTTAGTTTTTCTCAGTTTCTCTTTCTATAAATTACAGAGCCCAATGCTTTTAAAGGTCAAAAATGGCAAGATTGTTTTCTGTATTTTCACATTAAAAACAACAAATGTAAATATTGCTGCATGTTTTGAAAAAAGACCTAAATATCTGTCATTTTATACTATAAAAAAACTTTTTTTTATTCTGCATTTGTTGTATGAAAAAAATAGGATCTCGCCAGAGTCAGAAGTCAATAACTTGGTTGACATTTTTGGATGAACTACCTTTCTATACTTTCTAGCATTGACCCCACATCCTCTCTAACTGTCTGCTCCGTGTGTTGTACAGGTGGAGTATAGTGAGAAGGACAGTGCAGAGTGGTTTTCTCTGAGTAGCACCAGCACTAACGCAGAAGTGAAGAACCTGCAGCCCAGCTCGCTCTA[C/A]AGATTTAGGGTGAGATGCTCTGAGATCCTGCATGCTGCTGTTTCATGTGCACTTTTGGTTTGTTTCATTTAACCGCTCTTGTTCTGTTATTTCTCAGGTGGCTGCCGTCACAAGCAGAGGCGTTGGAAACTGGACAGAAATAAAGTCTATTATTCCTCAAAAAGGTAATTATGCTGTATAAACCCCATTGCGGAGCACTGGCTCCCCCTGCTGGACATTTACGCTCAAGCATTTTGTCTGATAAGGTTGTTGAAACCAAATACAATAGTCACGTAAATTCCCATTTCAGATTCTGTATTAATGGGTTAATTTGAAAAGAAAACCTTTCATACTAAAAAAGTGCTTACTTGTATAAACTTTGAATGGTAGTTTATCAGTTAATATTCACATGCAATATAATCCAAGTCAAACACTAAAAAATCAATTATATAAATAATCAAAATTGTATATTATGAAATACATATCAATGTCTCAATGACCTCTGCAGAGTAGACCACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1275
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011416 Essential Splice Site 1747 2045 38 44
Genomic Location (Zv9):
Chromosome 15 (position 20515721)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21618347
GRCz11 15 21554079
KASP Assay ID:
554-1190.1 (used for ordering genotyping assays)
KASP Sequence:
AGAGGCGTTGGAAACTGGACAGAAATAAAGTCTATTATTCCTCAAAAAGG[T/A]AATTATGCTGTATAAACCCCATTGCGGAGCACTGGCTCCCCCTGCTGGAC
Long Flanking Sequence:
TCACATTAAAAACAACAAATGTAAATATTGCTGCATGTTTTGAAAAAAGACCTAAATATCTGTCATTTTATACTATAAAAAAACTTTTTTTTATTCTGCATTTGTTGTATGAAAAAAATAGGATCTCGCCAGAGTCAGAAGTCAATAACTTGGTTGACATTTTTGGATGAACTACCTTTCTATACTTTCTAGCATTGACCCCACATCCTCTCTAACTGTCTGCTCCGTGTGTTGTACAGGTGGAGTATAGTGAGAAGGACAGTGCAGAGTGGTTTTCTCTGAGTAGCACCAGCACTAACGCAGAAGTGAAGAACCTGCAGCCCAGCTCGCTCTACAGATTTAGGGTGAGATGCTCTGAGATCCTGCATGCTGCTGTTTCATGTGCACTTTTGGTTTGTTTCATTTAACCGCTCTTGTTCTGTTATTTCTCAGGTGGCTGCCGTCACAAGCAGAGGCGTTGGAAACTGGACAGAAATAAAGTCTATTATTCCTCAAAAAGG[T/A]AATTATGCTGTATAAACCCCATTGCGGAGCACTGGCTCCCCCTGCTGGACATTTACGCTCAAGCATTTTGTCTGATAAGGTTGTTGAAACCAAATACAATAGTCACGTAAATTCCCATTTCAGATTCTGTATTAATGGGTTAATTTGAAAAGAAAACCTTTCATACTAAAAAAGTGCTTACTTGTATAAACTTTGAATGGTAGTTTATCAGTTAATATTCACATGCAATATAATCCAAGTCAAACACTAAAAAATCAATTATATAAATAATCAAAATTGTATATTATGAAATACATATCAATGTCTCAATGACCTCTGCAGAGTAGACCACTTGCGTATTATATACTTAGTGTTGATAATGTTTTTTTTTTATAAATGTATGTATACAGTTAATGTATAGATACAGTTACATTAATATGCTTAGGCAATATAATCAGTCAAATCTCACAAAATCAGTTATATAAATCATCAAAATTATATTTTATTAAATATATATCTAT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa22633
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011416 Nonsense 1778 2045 40 44
Genomic Location (Zv9):
Chromosome 15 (position 20513878)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21616504
GRCz11 15 21552236
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGGCATTATTAAAATATTTAACTCGCTTTCTGTTAGGTGAAGCTCTA[T/A]ATTGTAGTAATTTCTTGGGTATTTGATGAACATGTTAAGGAGAGCTGGAA
Long Flanking Sequence:
GAGATTTAAAAACAAGCTGCATACTAGTATCTTGATAAAATATGTAATTAAATATTATTTACTGTCATCATGACAAAATTATTAGAAATGAGCTATTAAAACTATTATGTTTAGAAATGTGTTGAATAAATGTTCTCTTCATTAAACAGAATTCTTCAAAAATGCACTTCAAAAATGTATAGGGGGCTAATAATTCAAGAGGGCAAATAATTCTGACTTCAACTGTATATACAGTTAAAACATATTACTCTTTACATCACACATATTAGTGTCTATTTTACTGTTTAGTAATCATGTATATTTGAATGTCTTTCAGCGCTCTCTCCACCTAAAGTGACGATCACCAGCATCACAGAAGACTCAATGAGTTTGTCCATCTCTAATGATTATAAGGTGAAGGTTAGTCAGTTTGCTGTTTCACTGATTTCTCTTGATTCGTCTATGTCCACCTTCAGGCATTATTAAAATATTTAACTCGCTTTCTGTTAGGTGAAGCTCTA[T/A]ATTGTAGTAATTTCTTGGGTATTTGATGAACATGTTAAGGAGAGCTGGAATTACACGGTCCCAGAAACACTGAAAGGTAAAACACTTAAAAACTCGTCATTAGGACCTCCTGTCAGCATTTCTAAAAGAAGATAGAAAGCGTGTGCTGTTTTCTGTGCAGTCTCTAACCTGACAGCAGGGACGGAGTATGAGGTGGCGGTGTGGGCTCACACTGATGATGGAGACAGTCCTACAGCCCTGTCCCGCCAGCAGACTAAAGGCAGCAGACCTGTCCAACCCTCACTAAAGGCCAGAGCCCTCAACCAGACTGCTGTAGACTGCAACTGGACTGGCCCGCCAGCAGAGGTTAGACTGTCTCCATCTAGTCATGATTTCAGTAATCCTATCACTAGTGTTTATATGGATACCTCACTGTTTCTATCTGGTGTTAGCATGAGTATGATAATGTCTCTTGTGATCATTTGTATTTTGATCTCTTCAAGGCACATACACTTTTATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3907
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011416 Essential Splice Site 1865 2045 41 44
Genomic Location (Zv9):
Chromosome 15 (position 20513531)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21616157
GRCz11 15 21551889
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCAACCAGACTGCTGTAGACTGCAACTGGACTGGCCCGCCAGCAGAGG[T/C]TAGACTGTCTCCATCTAGTCATGWTTTCAGTAATCCTATCACTAGTGTTT
Long Flanking Sequence:
CATCACAGAAGACTCAATGAGTTTGTCCATCTCTAATGATTATAAGGTGAAGGTTAGTCAGTTTGCTGTTTCACTGATTTCTCTTGATTCGTCTATGTCCACCTTCAGGCATTATTAAAATATTTAACTCGCTTTCTGTTAGGTGAAGCTCTATATTGTAGTAATTTCTTGGGTATTTGATGAACATGTTAAGGAGAGCTGGAATTACACGGTCCCAGAAACACTGAAAGGTAAAACACTTAAAAACTCGTCATTAGGACCTCCTGTCAGCATTTCTAAAAGAAGATAGAAAGCGTGTGCTGTTTTCTGTGCAGTCTCTAACCTGACAGCAGGGACGGAGTATGAGGTGGCGGTGTGGGCTCACACTGATGATGGAGACAGTCCTACAGCCCTGTCCCGCCAGCAGACTAAAGGCAGCAGACCTGTCCAACCCTCACTAAAGGCCAGAGCCCTCAACCAGACTGCTGTAGACTGCAACTGGACTGGCCCGCCAGCAGAGG[T/C]TAGACTGTCTCCATCTAGTCATGATTTCAGTAATCCTATCACTAGTGTTTATATGGATACCTCACTGTTTCTATCTGGTGTTAGCATGAGTATGATAATGTCTCTTGTGATCATTTGTATTTTGATCTCTTCAAGGCACATACACTTTTATTTTGTCCTGCTTTACATCAATTTCAGCTCCTAATGTGATCCACATTTACTATTGAATGAATGAATGAACGAATGAATGAATAAATGAAGCATTTTATTCACAAACATTTAAAGAAATGCTGTCATTTCAGTATGAGTTTCAGTGTTTGGGAAATTCATAAAAATAAGGTGAAAATATTGCTTTGTTTTGGTTTTTGGGAACACAACAACACCCATTGAGTTTTTTTATGAAAATATAGGCTGCCAGTAGTTCTTAATAAAACCAAATGTTTACAAACAAACCTATTTTCCCTTCTCTCTACAATAAATCATTTATACATTGGGCAGTATTCAGTTTTACAGTTAAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa774
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011416 Nonsense 1919 2045 43 44
Genomic Location (Zv9):
Chromosome 15 (position 20510313)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21612939
GRCz11 15 21548671
KASP Assay ID:
554-0679.1 (used for ordering genotyping assays)
KASP Sequence:
GTTGTTTAGGTGCGAGTGGTTTCTCCATACATGGGTCCTCCATCAAACTA[T/A]GCTGTAGTGAAGATGATCCCAGATGAGCGCCTTCCACCTCGTAACCTGCA
Long Flanking Sequence:
TGAGATGTTTGCATCACGGTATGTTCTAGGGATGGGATTTGCGTGACGCGCTGAGAGCTACTAGCCCGGCAGTAGAAACGCGACATGATTTGAGCCTCACTACTCAACCTCCCTAGCGATTGGCCCATCCTGGCCCGATAAAATCCCTGGCTTGCACTGGCCCGACAGTGGAAATAAAGCTATTGATCCTGCAGACTTTTCCAGTTTCATTTGTGACCAGACCTTTGAGCTAAAAATTATGTTTTTATTTTTCCACAGATGTACGCTGTGTTCTACGCAACCTCATTCCTGGATCTGTTTCGCAGACCTCACAGGGTGAACAGCACATCTAGCAGTCTAACTGTGATTGTTGACAGCGATGAGCAGTACCTTTTCCTGGTTAGTGTCCATCCTTCTGCTGCTCACTCGTCCATCCACTTTAACACCCAGATGAATTAATCAAATGTGTGTGTTGTTTAGGTGCGAGTGGTTTCTCCATACATGGGTCCTCCATCAAACTA[T/A]GCTGTAGTGAAGATGATCCCAGATGAGCGCCTTCCACCTCGTAACCTGCACAAAGTGCGAGTGGATAAAACGCAGGCCACTCTGAAGTGGCAGCCGCCGTATGATTCTCCCAGCAGTCCTTTGGTACATCTACATAGCTTTGCATGAAGTTATTTAATATTGTCAAATGAATTGTTTTAATCATATGTATTCTATATACCAGACATATGCTGTGCATGTGAGAGATACAGTTCGAAAAACCGAGAGCGACTATAAAGTGATCACTCAGAATAACACAGTGGAGTACACACTGAAGGGCCTGGAGCCGGCCGGACGCTACAGCATCACCATCAGACTGCTCAACATGAGCAAAGAAGCCAGCTATACACTCAGCACAGGTACAGCCATCTCTCTGATATTGTTTTTGTATGAAAATGTTGCATCACACATTATATTTATAGTCCTGCTCCATGTAGACTAAATCTCAGGGCATAGAATTAGAATTAAGATGCATTTTTGTC
Associated Phenotype:
Not determined