Busch Lab

ZMP

SPATA20

Ensembl ID:
ENSDARG00000013880
Description:
spermatogenesis associated 20 [Source:HGNC Symbol;Acc:26125]
Human Orthologue:
SPATA20
Human Description:
spermatogenesis associated 20 [Source:HGNC Symbol;Acc:26125]
Mouse Orthologue:
Spata20
Mouse Description:
spermatogenesis associated 20 Gene [Source:MGI Symbol;Acc:MGI:2183449]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa22115 Nonsense Available for shipment Available now
sa22116 Nonsense Available for shipment Available now
sa15455 Nonsense Available for shipment Available now
sa13025 Nonsense Available for shipment Available now
sa44766 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22115
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066288 Nonsense 104 818 2 16
Genomic Location (Zv9):
Chromosome 12 (position 29162275)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27499884
GRCz11 12 27591244
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAAAGACCCCAAAGTATACCAACCGCCTGAGTCAAGAGAAGTCCTCCTA[T/A]CTTTTACAACATGCACACAACCCTGTGGACTGGTGAGGGTCTCTGAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22116
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066288 Nonsense 128 818 3 16
Genomic Location (Zv9):
Chromosome 12 (position 29164482)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27502091
GRCz11 12 27593451
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTTGAACAGGTATCCATGGGGCCAAGAAGCCTTTGATAAAGCAAAATG[T/A]GAAGACAAGCCTATTTTTCTTTCAGGTAACGTAATATTATACTTGAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15455
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066288 Nonsense 412 818 10 16
Genomic Location (Zv9):
Chromosome 12 (position 29169758)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27507367
GRCz11 12 27598727
KASP Assay ID:
2260-5469.1 (used for ordering genotyping assays)
KASP Sequence:
CAGATTTGAKTTTGAGCATTGTGCTGCCCTCTGCAGTCTGGCGGCTTCTA[T/G]AGCGCTGAGGATGCAGAYTCCTTTCCCAYAGTGGAGTCCACAGAGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13025
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066288 Nonsense 412 818 10 16
Genomic Location (Zv9):
Chromosome 12 (position 29169758)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27507367
GRCz11 12 27598727
KASP Assay ID:
2260-5469.1 (used for ordering genotyping assays)
KASP Sequence:
CAGATTTGAKTTTGAGCATTGTGCTGCCCTCTGCAGTCTGGCGGCTTCTA[T/G]AGCGCTGAGGATGCAGAYTCCTTTCCCAYAGTGGAGTCCACAGAGAAGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27962
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066288 Splice Site, Nonsense 670 818 14 16
Genomic Location (Zv9):
Chromosome 12 (position 29193248)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27530857
GRCz11 12 27622217
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACAACTTTACTATAACATTTGTGTTTTATATGTATTATTTTTTTCAGAT[C/T]AGGACGGTGCTGAGCCTAGTGCAAACTCAGTGTCAGCCATGAATTTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44766
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066288 Splice Site, Nonsense 735 818 14 16
Genomic Location (Zv9):
Chromosome 12 (position 29193443)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27531052
GRCz11 12 27622412
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTGCCAGACATGGTCCGCGGTGTCATGGCCCACCATTACACTCTTAAA[C/T]AGGTAACGGCAGACTGGAGTACAGGCTACTGAATATGCAGTTTAAAGGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4470
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066288 Nonsense 776 818 16 16
Genomic Location (Zv9):
Chromosome 12 (position 29236054)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27573663
GRCz11 12 27665023
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTCTTCAGGTCCTGATGTTGGCAGATGGCAACACAGAGGGTTTCCTTTA[C/A]GATAAGCTTCCTATTCTCTCCACCCTGGTTCCTCAGGATGGCAAAGCAAC
Associated Phenotype:
Not determined