Busch Lab

ZMP

slc5a1

Ensembl ID:
ENSDARG00000013871
ZFIN ID:
ZDB-GENE-040426-1524
Description:
sodium/glucose cotransporter 1 [Source:RefSeq peptide;Acc:NP_956975]
Human Orthologues:
SLC5A1, SLC5A4
Human Descriptions:
solute carrier family 5 (low affinity glucose cotransporter), member 4 [Source:HGNC Symbol;Acc:11039
solute carrier family 5 (sodium/glucose cotransporter), member 1 [Source:HGNC Symbol;Acc:11036]
Mouse Orthologues:
Gm5134, Slc5a1, Slc5a4a, Slc5a4b
Mouse Descriptions:
predicted gene 5134 Gene [Source:MGI Symbol;Acc:MGI:3646667]
solute carrier family 5 (neutral amino acid transporters, system A), member 4b Gene [Source:MGI Symb
solute carrier family 5 (sodium/glucose cotransporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:107
solute carrier family 5, member 4a Gene [Source:MGI Symbol;Acc:MGI:1927848]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa13706 Essential Splice Site Available for shipment Available now
sa41620 Nonsense Mutation detected in F1 DNA Not yet available
sa12741 Nonsense Available for shipment Available now
sa41621 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41622 Nonsense Mutation detected in F1 DNA Not yet available
sa31773 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13706
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080449 Essential Splice Site 124 678 3 15

The following transcripts of ENSDARG00000013871 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16995322)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17197764
GRCz11 10 17155728
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGAACYGGAGCTGCTGCTGGAATCGCCATYGGAGGATTTGAGTGGAAC[G/A]TATGTTTAAAAAGTCTAAATATCATTCAAATATGGYAGGATATTATAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41620
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080449 Nonsense 160 678 5 15

The following transcripts of ENSDARG00000013871 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16996361)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17196725
GRCz11 10 17154689
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGGTTGTGACTATGCCAGAGTACCTAAAGAAGAGGTTTGGTGGTCAG[C/T]GAATCCGCATCTACCTCTCTGTGCTGTCACTGTGCCTCTACGTTTTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12741
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080449 Nonsense 177 678 5 15

The following transcripts of ENSDARG00000013871 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16996412)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17196674
GRCz11 10 17154638
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAATCCGCATCTACCTCTCTGTGCTGTCACTGTGCCTCTACGTTTTCACC[A/T]AAATYTCGGTGAGTCCAAAATCTGCTTCAAGACATACAAAAATAGYMTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41621
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080449 Essential Splice Site 394 678 10 15

The following transcripts of ENSDARG00000013871 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17006114)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17186972
GRCz11 10 17144936
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCACTAACATCGCTTATCCCAAACTTGTGGTGGACCTGATGCCAAATGG[T/G]AAACACTGTGCTGACATCTCTCTTTCTGATTTTACGGCACATGTCAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41622
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080449 Nonsense 427 678 11 15

The following transcripts of ENSDARG00000013871 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17008200)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17184886
GRCz11 10 17142850
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCACCTCCATCTTCAACAGCGCCAGCACACTCTTCACCATGGACATTTA[C/A]ACCAAGATCAGGCCCAAAGCCAAGGAAAAGGAGCTGATGATTGCCGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31773
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080449 Essential Splice Site 607 678 14 15

The following transcripts of ENSDARG00000013871 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17012203)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17180883
GRCz11 10 17138847
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAGACGACTGGACTGAGGACCAGGACTCCAACTCTATGGAAACAGATG[G/A]TACAGTACATCTGCACTATCCGTCTGATCGAGTGACATACTCACTGACTT
Associated Phenotype:
Not determined