Busch Lab

ZMP

armc1

Ensembl ID:
ENSDARG00000013861
ZFIN ID:
ZDB-GENE-041212-33
Description:
armadillo repeat-containing protein 1 [Source:RefSeq peptide;Acc:NP_001008609]
Human Orthologue:
ARMC1
Human Description:
armadillo repeat containing 1 [Source:HGNC Symbol;Acc:17684]
Mouse Orthologue:
Armc1
Mouse Description:
armadillo repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:1921502]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6769 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30104
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012399 Essential Splice Site None 275 1 7
ENSDART00000127044 Essential Splice Site None 243 1 8
Genomic Location (Zv9):
Chromosome 24 (position 25332010)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24578888
GRCz11 24 24724062
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACTGGACAGGAATCATCCGAAGCGAGGAGCGTCCTGGGCGTGTTTGCT[G/T]TAAGGTTATGCGTGGACAACACTCACTGTCACAACACACACAAGGTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6769
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012399 Essential Splice Site 85 275 3 7
ENSDART00000127044 Essential Splice Site 85 243 3 8
Genomic Location (Zv9):
Chromosome 24 (position 25322885)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24569763
GRCz11 24 24714937
KASP Assay ID:
554-4663.1 (used for ordering genotyping assays)
KASP Sequence:
TGAAGGGCGAGCTGGGAATGATGCTGAGCCTGCAGAACGTCATGCAGAAG[T/A]AAGTCACTGCCACAAAACWTGAAGCCAACACGARCTCGCTTTGCACTTTC
Associated Phenotype:
Not determined