Busch Lab

ZMP

abl2

Ensembl ID:
ENSDARG00000013841
ZFIN ID:
ZDB-GENE-020809-2
Description:
tyrosine-protein kinase ABL2 [Source:RefSeq peptide;Acc:NP_001116177]
Human Orthologue:
ABL2
Human Description:
v-abl Abelson murine leukemia viral oncogene homolog 2 [Source:HGNC Symbol;Acc:77]
Mouse Orthologue:
Abl2
Mouse Description:
v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene) Gene [Source:MGI

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa21232 Nonsense Available for shipment Available now
sa41154 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa7125 Nonsense Mutation detected in F1 DNA Not yet available
sa34353 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa13684 Essential Splice Site Available for shipment Available now
sa11098 Nonsense Available for shipment Available now
sa13149 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21232
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Nonsense 171 1135 3 11
ENSDART00000138548 Nonsense 171 587 3 10
Genomic Location (Zv9):
Chromosome 8 (position 15485188)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14930532
GRCz11 8 14968237
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCGGGAAAGCGAGAGCAGCCCCGGCCAGCTCTCCATCTCTCTTCGCTA[T/A]GAGGGACGGGTCTATCATTACCGCATCAACACGGCCTCTGATGGAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41154
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Essential Splice Site 307 1135 5 11
ENSDART00000138548 Essential Splice Site 307 587 5 10
Genomic Location (Zv9):
Chromosome 8 (position 15487663)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14933007
GRCz11 8 14970712
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTCAGTCATGAAGGAGGTCAAACATCCCAATCTAGTACAGTTACTGGG[T/C]GAGTAAACTATCATTAAAGGAAATAGTTCACCCAAAAATGAAAATAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7125
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Nonsense 338 1135 6 11
ENSDART00000138548 Nonsense 338 587 6 10
Genomic Location (Zv9):
Chromosome 8 (position 15489794)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14935138
GRCz11 8 14972843
KASP Assay ID:
554-5145.1 (used for ordering genotyping assays)
KASP Sequence:
ACATGCCCCATGGGAACCTGCTGGATTACCTGCGTGAGTGTGAAAGGGAC[C/T]AGGTGAATGCTGTGGTGCTGCTCTACATGGCYACTCAGATCTCCTCCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34353
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Splice Site, Nonsense 479 1135 9 11
ENSDART00000138548 Splice Site, Nonsense 479 587 9 10
Genomic Location (Zv9):
Chromosome 8 (position 15490760)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14936104
GRCz11 8 14973809
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTAGTTTTGAGGTATTAGGTAAGCATGTTTGGTTTGTGTATTGGCAGG[C/A]TGGCAGTGGAGTCCACTGGATAGACCCTCATTTGCTGAGATTCATCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13684
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Essential Splice Site 563 1135 None 11
ENSDART00000138548 None 563 587 10 10
Genomic Location (Zv9):
Chromosome 8 (position 15492320)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14937664
GRCz11 8 14975369
KASP Assay ID:
2260-0316.1 (used for ordering genotyping assays)
KASP Sequence:
TCAGAGAACAAAGAGAATATGGRGGAGGCAGGACCCCAYGGCCCTGCAGG[T/A]ATACAGGCTCAACTCCGGCTCAGTCGGCTCAGAAAGAAGCTCAAGAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11098
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Nonsense 988 1135 11 11
ENSDART00000138548 None None 587 None 10
ENSDART00000041697 Nonsense 988 1135 11 11
ENSDART00000138548 None None 587 None 10
Genomic Location (Zv9):
Chromosome 8 (position 15497005)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14942349
GRCz11 8 14980054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGWCCGTCAATACCACCACCACAAGTGCCTCCAGCCCCTGTAGTTCCCT[C/A]GAGTAACAACACMACCCAAACCAARTTGGCTAATGGTGCTTCAAGTGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13149
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Nonsense 988 1135 11 11
ENSDART00000138548 None None 587 None 10
ENSDART00000041697 Nonsense 988 1135 11 11
ENSDART00000138548 None None 587 None 10
Genomic Location (Zv9):
Chromosome 8 (position 15497005)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14942349
GRCz11 8 14980054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGWCCGTCAATACCACCACCACAAGTGCCTCCAGCCCCTGTAGTTCCCT[C/A]GAGTAACAACACMACCCAAACCAARTTGGCTAATGGTGCTTCAAGTGGCG
Associated Phenotype:
Not determined