Busch Lab

ZMP

zgc:56538

Ensembl ID:
ENSDARG00000013795
ZFIN ID:
ZDB-GENE-040426-1068
Description:
light ear protein [Source:RefSeq peptide;Acc:NP_956620]
Human Orthologue:
HPS4
Human Description:
Hermansky-Pudlak syndrome 4 [Source:HGNC Symbol;Acc:15844]
Mouse Orthologue:
Hps4
Mouse Description:
Hermansky-Pudlak syndrome 4 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:2177742]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa41267 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa7150 Nonsense Mutation detected in F1 DNA Not yet available
sa7151 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41267
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017153 Essential Splice Site 12 647 2 13
Genomic Location (Zv9):
Chromosome 8 (position 41722851)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39736431
GRCz11 8 39770205
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAACAGATCACCAATGGCTGAAAGTGCTGTTTTGGCCGATTCCAGACGG[T/G]GAGCGTAATATTCAGCTTATTATATTAGTGTGCAAATCTTTTTTGCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7150
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017153 Nonsense 484 647 10 13
Genomic Location (Zv9):
Chromosome 8 (position 41734180)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39747760
GRCz11 8 39781534
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACCAAATGAARCCAMGRAAGACCCCTYGCTASTCCCCTCGATATTATA[C/A]CAGCATAGGGTCCGAGGCCTGGTTCTGGCTCTCCTGGTAGAGCCTGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7151
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017153 Essential Splice Site 511 647 10 13
Genomic Location (Zv9):
Chromosome 8 (position 41734263)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39747843
GRCz11 8 39781617
KASP Assay ID:
554-4802.1 (used for ordering genotyping assays)
KASP Sequence:
CCTGGTAGAGCCTGAATTCARCACGGACCCAGCAGCCAGAGAAGAAGTGG[T/A]GAGAAGTAAATCGGTTATACTTGACGTGGATGGGTTTGGAGTCAGTAAGA
Associated Phenotype:
Not determined