Busch Lab

ZMP

si:dkey-76k16.7

Ensembl ID:
ENSDARG00000013763
ZFIN IDs:
ZDB-GENE-030131-9795, ZDB-GENE-080401-3
Description:
hypothetical protein LOC553448 [Source:RefSeq peptide;Acc:NP_001139027]
Human Orthologue:
RRBP1
Human Description:
ribosome binding protein 1 homolog 180kDa (dog) [Source:HGNC Symbol;Acc:10448]
Mouse Orthologue:
Rrbp1
Mouse Description:
ribosome binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1932395]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa10197 Nonsense Available for shipment Available now
sa42244 Nonsense Mutation detected in F1 DNA Not yet available
sa45493 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14359 Nonsense Available for shipment Available now
sa6321 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa452
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017523 Essential Splice Site 546 1336 2 28
ENSDART00000075764 None None 373 None 4
ENSDART00000124034 None None 363 None 2
ENSDART00000130986 None None 353 None 2
ENSDART00000133073 Essential Splice Site 546 1336 3 29
ENSDART00000138181 None None 391 None 9

The following transcripts of ENSDARG00000013763 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 33857679)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33523659
GRCz11 13 33633204
KASP Assay ID:
554-0379.1 (used for ordering genotyping assays)
KASP Sequence:
TTCAGATTCTGTCTGATAAGGCTGGTATTATTCAGGACACATGGCAAAAG[G/A]TATGGCCATAAATGGTTTTATATTTTTAAATGAGTCTTATTAATACACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10197
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017523 Nonsense 737 1336 7 28
ENSDART00000075764 None None 373 None 4
ENSDART00000124034 None None 363 None 2
ENSDART00000130986 None None 353 None 2
ENSDART00000133073 Nonsense 737 1336 8 29
ENSDART00000138181 None None 391 None 9

The following transcripts of ENSDARG00000013763 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 33849628)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33515608
GRCz11 13 33625153
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGWGTTCTTATGTTTTGTCYGCTGCAGGCGAGCAGGGCGAAYGCTGAA[C/T]AAGCTCTGCAGAAGCGTCTGGAGGAAGTGAGTGAGGAGCTCAGACAGACM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42244
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017523 Nonsense 799 1336 8 28
ENSDART00000075764 None None 373 None 4
ENSDART00000124034 None None 363 None 2
ENSDART00000130986 None None 353 None 2
ENSDART00000133073 Nonsense 799 1336 9 29
ENSDART00000138181 None None 391 None 9

The following transcripts of ENSDARG00000013763 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 33849183)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33515163
GRCz11 13 33624708
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGTGTGGAGGTGGAAATGAAAGAGCGGACTGGACATTTGGAGAGTCTG[C/T]AGAGCCAGCTGAAACAGACGCAGACAGAGAGAGAGCAGCAGCTGAAAGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28158
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017523 Nonsense 871 1336 11 28
ENSDART00000075764 None None 373 None 4
ENSDART00000124034 None None 363 None 2
ENSDART00000130986 None None 353 None 2
ENSDART00000133073 Nonsense 871 1336 12 29
ENSDART00000138181 None None 391 None 9

The following transcripts of ENSDARG00000013763 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 33847122)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33513102
GRCz11 13 33622647
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTTTCCATTGTTCATTGTAGGTGGATAGCACAACAGATGTGCAGCATT[T/A]ACAGCAAAGGTACAATGTTTTCTGTAGCTTCTCTAATACACTTCAGTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45493
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017523 Essential Splice Site 953 1336 None 28
ENSDART00000075764 None None 373 None 4
ENSDART00000124034 None None 363 None 2
ENSDART00000130986 None None 353 None 2
ENSDART00000133073 Essential Splice Site 953 1336 None 29
ENSDART00000138181 None None 391 None 9

The following transcripts of ENSDARG00000013763 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 33846502)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33512482
GRCz11 13 33622027
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTACAGCTGGCAGACAGCACAGCCCAACTAGATTCACTACATAAAAGG[T/A]ACATAATCAGACCCACTGAAGGCCACTGCATGTTTATGTGCCTCCCTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14359
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017523 Nonsense 965 1336 16 28
ENSDART00000075764 None None 373 None 4
ENSDART00000124034 None None 363 None 2
ENSDART00000130986 None None 353 None 2
ENSDART00000133073 Nonsense 965 1336 17 29
ENSDART00000138181 None None 391 None 9

The following transcripts of ENSDARG00000013763 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 33846337)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33512317
GRCz11 13 33621862
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TYNNNNNNNNATGGTGTTTTTCAGMATATCTGAAAAAGAGAGCTTGATGACAACACTA[C/T]AACAGGAAGTACAGCAGCTCAAGGAACTAAACCAGTCACAAAGCAAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6321
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017523 Essential Splice Site 1013 1336 17 28
ENSDART00000075764 None None 373 None 4
ENSDART00000124034 None None 363 None 2
ENSDART00000130986 None None 353 None 2
ENSDART00000133073 Essential Splice Site 1013 1336 18 29
ENSDART00000138181 None None 391 None 9

The following transcripts of ENSDARG00000013763 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 33845744)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33511724
GRCz11 13 33621269
KASP Assay ID:
554-5433.1 (used for ordering genotyping assays)
KASP Sequence:
AAGAAGTTCTTCACTCTCTTTTCCCACACATCAATATAGAGACAGCAAAG[G/A]TATTTAGGGTTTAAGTCGTCTCGTAGTTTCATTTCCCAGTTCTGTTTTTC
Associated Phenotype:
Not determined