Busch Lab

ZMP

zgc:73056

Ensembl ID:
ENSDARG00000013750
ZFIN ID:
ZDB-GENE-040426-1651
Description:
zgc:73056 [Source:RefSeq peptide;Acc:NP_956989]
Human Orthologue:
ENO1
Human Description:
enolase 1, (alpha) [Source:HGNC Symbol;Acc:3350]
Mouse Orthologues:
Eno1, Gm5506
Mouse Descriptions:
enolase 1, alpha non-neuron Gene [Source:MGI Symbol;Acc:MGI:95393]
predicted gene 5506 Gene [Source:MGI Symbol;Acc:MGI:3648653]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa30876 Nonsense Mutation detected in F1 DNA Not yet available
sa40761 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30876
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103842 Nonsense 5 433 2 12
ENSDART00000142492 None None 374 None 9
Genomic Location (Zv9):
Chromosome 6 (position 40593498)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40665098
GRCz11 6 40662634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAATCTATCTTTTTATCAATTAGATTTTTAAAGAAAGATGTCTATTCTG[A/T]AGATACACGCTCGTGAGATTTTTGATTCTAGGGGCAACCCCACTGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40761
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103842 Nonsense 163 433 7 12
ENSDART00000142492 Nonsense 104 374 4 9
Genomic Location (Zv9):
Chromosome 6 (position 40596328)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40667928
GRCz11 6 40665464
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAAAGGCCTTTAATGTGATCAATGGCGGCTCTCATGCTGGCAATAAAT[T/A]GGCCATGCAGGAGTTCATGATTCTGCCGGTCGGGGCCAGCAGCTTTAAGG
Associated Phenotype:
Not determined