Busch Lab

ZMP

ap4b1l

Ensembl ID:
ENSDARG00000013726
ZFIN ID:
ZDB-GENE-040426-1284
Description:
AP-4 complex subunit beta-1 [Source:RefSeq peptide;Acc:NP_956632]
Human Orthologue:
AP4B1
Human Description:
adaptor-related protein complex 4, beta 1 subunit [Source:HGNC Symbol;Acc:572]
Mouse Orthologue:
Ap4b1
Mouse Description:
adaptor-related protein complex AP-4, beta 1 Gene [Source:MGI Symbol;Acc:MGI:1337130]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa9375 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa29847 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9375
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018230 Essential Splice Site 400 729 7 11
ENSDART00000116215 Essential Splice Site 400 729 6 10
ENSDART00000018230 Essential Splice Site 400 729 7 11
ENSDART00000116215 Essential Splice Site 400 729 6 10
Genomic Location (Zv9):
Chromosome 23 (position 376595)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 347586
GRCz11 23 360379
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATATCCTGACCRGCCTGCTGGCACTRAAGCAGGATCACATCACATCCGG[T/A]ACGAGAACACACACACCTCTGCATGATTTCTCTTATTGTTCACCCAAACA
Long Flanking Sequence:
ACCTTTACTTCCTTAGCTGTAACAAGATATTATTATTATCACAGCGGAATGAACCGCCAACTATTCCAGCGTATGTTTTACACTGTGGATGGCCTTCCACCTGCAACCCAGTACTGGGAAACCATATAACCCATATACACCTATTCACACTCATACACTACAGCCAGTTTAGTTGATCAGTTCCCCTATAGTGCATGTGTTTGGACTGGGAAACCGGAGCACCCGGAGGAAACCCATGCCAACACGGGGAGAACATGCAAACTCCACACAGAAACACCAACTGACCCAGCCGAGACTCAAACCAGTGACCTTCATACTGTGAGGCCACAGTGCTAACCACTGAGCCACTGTGCTGCTGTTGTTATCAGTACAGCTGTGTGTTTTCTTATTGCACATGTTTCTTTCTGGTGTCCAGGGCGTATAGGGCGAACATACAGCGAGAAGTGTCTGGATATCCTGACCGGCCTGCTGGCACTGAAGCAGGATCACATCACATCCGG[T/A]ACGAGAACACACACACCTCTGCATGATTTCTCTTATTGTTCACCCAAACATCATCATTTACACTCCTTCTACTTGTATTAAACCTTTATGAGTTTCTTTCTTCTGTTCAGCACAAATGAAGATATTTTGAAGAATGTTGGAAACCGGTAACCATTGACCTCCATAGTATTTGTTTTGGAAAGTCAGGGGTTACCGGCTTTCAGCATTCTTCAAAATATCTTCATTTGGGTGAACAGGAAAGAAACTCAAAGGACTTGATCTTAGTGTTCCCGGGTAACCATTTACTTCTACAGGATTAGATTAAATAAATTTAGAGTAAATATGGTATTTAAAAGGGGGGGGGGGGGGGATAAATATTCCTTTATTACAGGTATGTCACAAAATAAGTGACAAAATGGTAGTGTATGATACTTGGTAACCATTGACTTCCATAGATTTGTTTTTCCTACTATGCAAGTGAATGGTTACCGGTTTTCAGCATTCTTCAAAATATCTTCTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5014
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018230 Essential Splice Site 400 729 7 11
ENSDART00000116215 Essential Splice Site 400 729 6 10
ENSDART00000018230 Essential Splice Site 400 729 7 11
ENSDART00000116215 Essential Splice Site 400 729 6 10
Genomic Location (Zv9):
Chromosome 23 (position 376595)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 347586
GRCz11 23 360379
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATATCCTGACCRGCCTGCTGGCACTRAAGCAGGATCACATCACATCCGG[T/A]ACGAGAACACACACACCTCTGCATGATTTCTCTTATTGTTCACCCAAACA
Long Flanking Sequence:
ACCTTTACTTCCTTAGCTGTAACAAGATATTATTATTATCACAGCGGAATGAACCGCCAACTATTCCAGCGTATGTTTTACACTGTGGATGGCCTTCCACCTGCAACCCAGTACTGGGAAACCATATAACCCATATACACCTATTCACACTCATACACTACAGCCAGTTTAGTTGATCAGTTCCCCTATAGTGCATGTGTTTGGACTGGGAAACCGGAGCACCCGGAGGAAACCCATGCCAACACGGGGAGAACATGCAAACTCCACACAGAAACACCAACTGACCCAGCCGAGACTCAAACCAGTGACCTTCATACTGTGAGGCCACAGTGCTAACCACTGAGCCACTGTGCTGCTGTTGTTATCAGTACAGCTGTGTGTTTTCTTATTGCACATGTTTCTTTCTGGTGTCCAGGGCGTATAGGGCGAACATACAGCGAGAAGTGTCTGGATATCCTGACCGGCCTGCTGGCACTGAAGCAGGATCACATCACATCCGG[T/A]ACGAGAACACACACACCTCTGCATGATTTCTCTTATTGTTCACCCAAACATCATCATTTACACTCCTTCTACTTGTATTAAACCTTTATGAGTTTCTTTCTTCTGTTCAGCACAAATGAAGATATTTTGAAGAATGTTGGAAACCGGTAACCATTGACCTCCATAGTATTTGTTTTGGAAAGTCAGGGGTTACCGGCTTTCAGCATTCTTCAAAATATCTTCATTTGGGTGAACAGGAAAGAAACTCAAAGGACTTGATCTTAGTGTTCCCGGGTAACCATTTACTTCTACAGGATTAGATTAAATAAATTTAGAGTAAATATGGTATTTAAAAGGGGGGGGGGGGGGGATAAATATTCCTTTATTACAGGTATGTCACAAAATAAGTGACAAAATGGTAGTGTATGATACTTGGTAACCATTGACTTCCATAGATTTGTTTTTCCTACTATGCAAGTGAATGGTTACCGGTTTTCAGCATTCTTCAAAATATCTTCTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5015
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018230 Nonsense 455 729 9 11
ENSDART00000116215 Nonsense 455 729 8 10
Genomic Location (Zv9):
Chromosome 23 (position 381603)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 352594
GRCz11 23 365387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTTGTGGCTGCTGGGCGAGCATGYGGATCAGATCAGCAGCGCCCCCTA[T/A]CTGCTGGAGGTCTACATCGACGGGCTGAAGACGGAGCTGTCTGCGSCGCT
Long Flanking Sequence:
TCTGCAAAACACTTCAGATCATCAGAGAGTAGCAGTGTATGAATGCAAATAGCAGAACGTTATCATCTAAATCAGGAAAAGTGCATTCATCCATTCATTCATCCATTCATTCATTCATTCATTCATTTTCCCTTGGCCTAGTCTCTTAATTATCAGGGATCACCACAGTGGAATGAACCGTTAACGATTCTAGCATATGTTTTACTTCCAGCTGCAATCCAGCACTGGGAAACACCCATACACACTCATTCTCACACACAAACACACACTCATACATTACGGCCAGTGTAGTTGATCAGTTCCCCTATAGTGCATGTGTTTGGACTGTGGGGGCAACCGGAGCACCCGGGTACTTTAATATAGGCAGTAGTTCAGAGCCGTGAGCTGAACTGAAGGGTCAGGGTGAGAGTGAGTGAGATGTATTGTTGTGCTTGTCAGGGAAAGCAGGCTCTGTTGTGGCTGCTGGGCGAGCATGCGGATCAGATCAGCAGCGCCCCCTA[T/A]CTGCTGGAGGTCTACATCGACGGGCTGAAGACGGAGCTGTCTGCGCCGCTGAAGATGGAGATACTGACCGCAGCACTCAAGATGTTCCTGAGACGCCCTGCTGAGACACAAGACATGCTGGGCCGTCTGCTGCACTACTGCATAGGTGATAGAGGACGACATGTCTGTCTGTCTGTCAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTCTCTCTGCCTGTGTCTGTCTGTCTGTCTCTGTGTGTCTGTTGTTCTGCCTTTGTCTGTCTGTCTGTCTGTTATTCTGTCTATCTTTGCCTGTTTGTCTGTTGTTCTGTCTGTCTGTGTTTGTTGTTCTGTCTGTGTCTGTTGTTCTGTCTGTCTCTCTGTCTGTCTGTTGTTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTGGCTGTTTTTCTGTCTGTCTGTGTTTGTTGTTCTATCTATCTGTCTGTCGTTCTGTTTGTGTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29847
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018230 Nonsense 627 729 11 11
ENSDART00000116215 Nonsense 627 729 10 10
Genomic Location (Zv9):
Chromosome 23 (position 383552)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 354543
GRCz11 23 367336
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTGTGTGCGGGTGCTGCTGTGTCCCCCGAGGCGTTTGAGCAGATGTGG[C/T]AGCAGCTGGAGGTCCTGCAGCGTCAGACGGTGTGTTTCTCTGGATGCGCA
Long Flanking Sequence:
TCCATCTCATTAGCATAAACAGCAGGCCTGAGTGAGAAGCAGCCGTCTGTCCATTAGCCATTAGAGTGTTTGAATCGGCCACTATGCTGACACACAGGTGTCTGTAGCTCCGCCCTCTTCTGAAAAGAGCACAATCTCATTTGCATTTAAAGCGACAGTCACCAAAACACCACAATCAGGATCAAAGCCTGAAAGGGTCAGTTTTAGAGAGCTGGAAAACATCATCTGTGTGTATTCTCAGCTCAAACACACACACACACACACACACACACTCTAGAGACAGCAGAGTCGCATTTACATTCTCAACCCACCCTGCACATTCCCCTTTAATCTTTCATCTCTGGTTTTGAAAGTGCTGAATAAGAGCGTAACGCTGTACTCCACCATTGTGTCTCTGCCTGCCAGAACACGTCCCCGTCTCCATGCGGGACGTCTCAGAAGCAGGTGTCAGCCTGTGTGCGGGTGCTGCTGTGTCCCCCGAGGCGTTTGAGCAGATGTGG[C/T]AGCAGCTGGAGGTCCTGCAGCGTCAGACGGTGTGTTTCTCTGGATGCGCAGCGGACACACTTCAGAGCGCCCTGCAGCCGGTGCACATCCAGACTCTGGCCTTCAGCCCGGCCCGCGCGCTACCCTGGAGGGCCTACATCTATAGCAGGGGCTCCGGGACGCTCGTCCTAGCTGAACTGCTGCAGGATGACCCGGAGATGCTGACGGTGACTGTAAAACAGCAGCCCGAACACCAGCAGACCGTCACTGCATTCATCAGTGTGTTGCAGAGCGTCCTGCAGACTCTCAATACAGGACAAATGAGTGTTTAAATGATTTGCTGTGGTGCTACACTAATAAAAGAAGTCAACCTTTGGATCAACTTGTACTGTAGGGATCAGGGTGATAACAGGGGTCGGATCTAGATTCAGTTTAATTAAAGGTGCAGTAAGTTTGACACCCAGTGGTTGAAGTAGGTATTGCACGTCTGGTTCAACACACACACAAGTGCAGGTTGCCAG
Associated Phenotype:
Not determined