Busch Lab

ZMP

usp9

Ensembl ID:
ENSDARG00000013708
ZFIN ID:
ZDB-GENE-061019-1
Description:
probable ubiquitin carboxyl-terminal hydrolase FAF-X [Source:RefSeq peptide;Acc:NP_001070917]
Human Orthologues:
USP9X, USP9Y
Human Descriptions:
ubiquitin specific peptidase 9, X-linked [Source:HGNC Symbol;Acc:12632]
ubiquitin specific peptidase 9, Y-linked [Source:HGNC Symbol;Acc:12633]
Mouse Orthologues:
Usp9x, Usp9y
Mouse Descriptions:
ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI Symbol;Acc:MGI:894681]
ubiquitin specific peptidase 9, Y chromosome Gene [Source:MGI Symbol;Acc:MGI:1313274]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa38749 Nonsense Mutation detected in F1 DNA Not yet available
sa8794 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18950 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11012 Nonsense Available for shipment Available now
sa18951 Nonsense Mutation detected in F1 DNA Not yet available
sa21524 Essential Splice Site Available for shipment Available now
sa21525 Splice Site, Nonsense Available for shipment Available now
sa16185 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27432
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025635 Essential Splice Site 776 2551 15 45
ENSDART00000122803 Essential Splice Site 776 2594 15 46
ENSDART00000135384 Essential Splice Site 776 2551 16 46
Genomic Location (Zv9):
Chromosome 9 (position 34323384)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33479330
GRCz11 9 33290076
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATATGATGGATGACTTGGAGCTTATAGGGCTGGATTACCTGTGGAGGG[T/G]AAGAGTCAGTTACAGCTGTAGGGTTGTCTTGGGAATGTTAAGAGCTTGCT
Long Flanking Sequence:
ACTTTTCCACTTGTTTTCTGTTTAATCTTTTTTTAGAGCTAAAACTAAAACACACGCAAAACCTGAGATTGTAAACCTTCCAATACGCTCAAGCAATCAAAAGTCAAACAATGATTCAAAGTCTCTTTCACCTCACTAAATCTTGTCATCCTTCAGATTCTTACTGAAAGATGGGCAGCTCTGGCTATGCGCTCCCCAGGCTAAGCAGATCTGGAAGTGCCTGGCGGAGAATGCTGTGTTCTTGTGTGATCGGGAGGCCTGCTTTAAATGGTACTCCAAACTGATGGGGGACGAACCTGACCTTGACCCTGACATCAACAAGGACTTCTTTGAGAACAATGTGCTGCAACTCGACCCCTCACTGCTGACGGAGAACGGGATGAAATGCTTTGAGCGATTTTTCAAGGCTGTCAACTGCAGGGAGGGCAAACTGGTTGCAAAACGGCGGGCGTATATGATGGATGACTTGGAGCTTATAGGGCTGGATTACCTGTGGAGGG[T/G]AAGAGTCAGTTACAGCTGTAGGGTTGTCTTGGGAATGTTAAGAGCTTGCTTGATCATAGTTATTCATTTATTACATTTTATTTTGGATTATTATTGTATTTATTTATTAATTTAAATATGATGCAGTGTTTTGATGGAATTAAACCAATGTCAAATTACATTTAGCGAAATAAAAAATAGTCCAAGCTCAAACCATCTCTTCATTTTCAGGTTGTGATTCAAGGAAGCGATGATATTGCTAGCCGAGCAATTGACTTGCTTAAAGAGATTTATACAAACCTTGGACCAAAATTACAAGCCAATCAGGTATGTTTTATATATCACTGGTTGTAAAAAAATTTTGAGCTGTTCTTGTGCATGTTTTAAAATGTGTCTCATGTTTGCAGGTTGAGATTCATGAGGATTTTATTCAGTCTTGCTTTGACCGGCTCAAAGCCTCCTATGACACTTTGTGTGTGCTGGACGGAGATAAAGACAGCATTAACTGCGCCAGGCAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38749
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025635 Nonsense 898 2551 18 45
ENSDART00000122803 Nonsense 898 2594 18 46
ENSDART00000135384 Nonsense 898 2551 19 46
Genomic Location (Zv9):
Chromosome 9 (position 34324161)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33480107
GRCz11 9 33290853
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGAGGAAAGCATATCACACTAGTTGTGCGTTTTCCAAACCAAGGCCGA[C/T]AGGTTGATGATCTGGACATTTGGTCACATACCAATGACACAATTGGTTCT
Long Flanking Sequence:
AACCTTGGACCAAAATTACAAGCCAATCAGGTATGTTTTATATATCACTGGTTGTAAAAAAATTTTGAGCTGTTCTTGTGCATGTTTTAAAATGTGTCTCATGTTTGCAGGTTGAGATTCATGAGGATTTTATTCAGTCTTGCTTTGACCGGCTCAAAGCCTCCTATGACACTTTGTGTGTGCTGGACGGAGATAAAGACAGCATTAACTGCGCCAGGCAGGAGGCCATTCGCATGGTGAGAGTACTGACTGTGCTCAGGGAGTATATAACAGAGTGTGACAGCGACTACCATGAGGAAAGGACCATCCTGCCCATGTCCAGGTAGAGTTATTCAAACCTATCATAAAGTAACAGAATTAAATTCCTATTTTTGCCTGCCTCTGATGTCAGATTTTATATATATATATATATATATAAAAACTTTTTTTTTTCTGGTTCTTTCAGGGCTTTTAGAGGAAAGCATATCACACTAGTTGTGCGTTTTCCAAACCAAGGCCGA[C/T]AGGTTGATGATCTGGACATTTGGTCACATACCAATGACACAATTGGTTCTGTGCGACGCTGCATCCTAAACCGAATAAAGGCAAACAGCACACACACAAAGATTGAACTCTTCATCGGAGGAGAGATCATTGACCCAGCAGATGACAGGAAGCTAATTGGGCAGCTAAACCTCAAAGACAAAACAGTAGGCATTTGCTTGGCTCTTTTTCTTAATTATAACATGCACAGACCATGTCAAGGCAGCACTTCTCTGTGTTTCTTTAATACATGTAGACACAAATTACTTGACTCTTTTGAGGGGTTTTTTTTTATGCAAGCTGTTATAATGCCTGTGTTTGCAAATGTACATGCCTGTAAACTAAAAATACTTTTGGATCCAAATTGAGCAACCTACAACCTCATGTGCACAAATTTATACTAATATTCAGCATTTTCAGTGTGCTTGTTGACAAATTTAAAGTTAGCATGTTGCTACAGTTTCACAATTTATTTTAAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8794
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025635 Essential Splice Site 1009 2551 19 45
ENSDART00000122803 Essential Splice Site 1009 2594 19 46
ENSDART00000135384 Essential Splice Site 1009 2551 20 46
ENSDART00000025635 Essential Splice Site 1009 2551 19 45
ENSDART00000122803 Essential Splice Site 1009 2594 19 46
ENSDART00000135384 Essential Splice Site 1009 2551 20 46
Genomic Location (Zv9):
Chromosome 9 (position 34326908)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33482854
GRCz11 9 33293600
KASP Assay ID:
2260-2074.1 (used for ordering genotyping assays)
KASP Sequence:
CTACAGTGATKGGCCAAACCCTGAAGTAGAGAGCTGTCTTCCTGGTGTGG[T/C]GAGCATCATTTYATGCAGGCACATGATTGAGCCTAATTGTCAATTTTGTT
Long Flanking Sequence:
TAACAAGAGGCGATTCAATCTTAACTTAATGTTATAACCGCTATTGTAACATTATTTATCAATATGTTGAACTTTTTGGACTCGAAAACTGTGGAAATTTTAAATGTAAAACAGGAAACACGTCAAAACCATTGTTATTGCTTACACCCCTCAAATTAGTCTATAAATCAATGGCTGTTGTCAACTATTTGGTTACCAGCATTCTCCAGGAGACTAAGAAAATGGTGCAAGCATTTGAAGGGAGAGTAAATGATTACAGATGTTTTATTCTCTGGTGAAGTCTCTCTTTAAATGTAAGGTCATATGTGAACAGGATGTGTTGTAGTTAAAAGTATTCTCTCTCTCACAGCTCATCACAGCCAAGCTCACCCAGGTCAGCGCCAACATGCCTTCCAGTCCAGACAGCTCCTCAGACTCCTCCACTGGTTCCCCTGGGAATCATGGCAATCACTACAGTGATGGGCCAAACCCTGAAGTAGAGAGCTGTCTTCCTGGTGTGG[T/C]GAGCATCATTTTATGCAGGCACATGATTGAGCCTAATTGTCAATTTTGTTAGTGAAGTGATTACATATTGAACATATTTAAAGGCAAGCAGTCATGAGAAATTAAGATAAGAAGATTGTCTTCAAAAACTGATGTTAATAACTTGTGTGCATTTCCATCTGTAGACCATCTGTTAAATTAAAAGGCAACCAGTGACCTAAATTAACTAGGTAACCTGCTTCCAAACAAGATAACTGCCCGTTTTATATATTTTAATGTCTCCGGCTGGCATTCAGAAGTTATTCACATTTATTTAAAAAGTATAATGCAGTATTGTTTTTGTTTTGTTTTTGCTTGTGATCAGACTAATTTGGTTGCTATGTTCTGTAAAGTATTCTAATTAATGTCCATTTTCACAACGTATTTCAGTGTTAAACGAGATGATTAAAAACATTTATTGTAAAGAATTGCTTTACCAAAACACAAAGCATTGTGTAACATTCTATAAGTTCACTTTACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18950
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025635 Essential Splice Site 1009 2551 19 45
ENSDART00000122803 Essential Splice Site 1009 2594 19 46
ENSDART00000135384 Essential Splice Site 1009 2551 20 46
ENSDART00000025635 Essential Splice Site 1009 2551 19 45
ENSDART00000122803 Essential Splice Site 1009 2594 19 46
ENSDART00000135384 Essential Splice Site 1009 2551 20 46
Genomic Location (Zv9):
Chromosome 9 (position 34326908)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33482854
GRCz11 9 33293600
KASP Assay ID:
2260-2074.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACAGTGATGGGCCAAACCCTGAAGTAGAGAGCTGTCTTCCTGGTGTGG[T/C]GAGCATCATTTTATGCAGGCACATGATTGAGCCTAATTGTCAATTTTGTT
Long Flanking Sequence:
TAACAAGAGGCGATTCAATCTTAACTTAATGTTATAACCGCTATTGTAACATTATTTATCAATATGTTGAACTTTTTGGACTCGAAAACTGTGGAAATTTTAAATGTAAAACAGGAAACACGTCAAAACCATTGTTATTGCTTACACCCCTCAAATTAGTCTATAAATCAATGGCTGTTGTCAACTATTTGGTTACCAGCATTCTCCAGGAGACTAAGAAAATGGTGCAAGCATTTGAAGGGAGAGTAAATGATTACAGATGTTTTATTCTCTGGTGAAGTCTCTCTTTAAATGTAAGGTCATATGTGAACAGGATGTGTTGTAGTTAAAAGTATTCTCTCTCTCACAGCTCATCACAGCCAAGCTCACCCAGGTCAGCGCCAACATGCCTTCCAGTCCAGACAGCTCCTCAGACTCCTCCACTGGTTCCCCTGGGAATCATGGCAATCACTACAGTGATGGGCCAAACCCTGAAGTAGAGAGCTGTCTTCCTGGTGTGG[T/C]GAGCATCATTTTATGCAGGCACATGATTGAGCCTAATTGTCAATTTTGTTAGTGAAGTGATTACATATTGAACATATTTAAAGGCAAGCAGTCATGAGAAATTAAGATAAGAAGATTGTCTTCAAAAACTGATGTTAATAACTTGTGTGCATTTCCATCTGTAGACCATCTGTTAAATTAAAAGGCAACCAGTGACCTAAATTAACTAGGTAACCTGCTTCCAAACAAGATAACTGCCCGTTTTATATATTTTAATGTCTCCGGCTGGCATTCAGAAGTTATTCACATTTATTTAAAAAGTATAATGCAGTATTGTTTTTGTTTTGTTTTTGCTTGTGATCAGACTAATTTGGTTGCTATGTTCTGTAAAGTATTCTAATTAATGTCCATTTTCACAACGTATTTCAGTGTTAAACGAGATGATTAAAAACATTTATTGTAAAGAATTGCTTTACCAAAACACAAAGCATTGTGTAACATTCTATAAGTTCACTTTACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11012
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025635 Nonsense 1822 2551 34 45
ENSDART00000122803 Nonsense 1826 2594 34 46
ENSDART00000135384 Nonsense 1822 2551 35 46
ENSDART00000025635 Nonsense 1822 2551 34 45
ENSDART00000122803 Nonsense 1826 2594 34 46
ENSDART00000135384 Nonsense 1822 2551 35 46
Genomic Location (Zv9):
Chromosome 9 (position 34336875)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33492821
GRCz11 9 33303567
KASP Assay ID:
2260-2075.1 (used for ordering genotyping assays)
KASP Sequence:
AAGTTCAATGACTACTTTGAGTTTCCWCGRGAGTTGGACATGGAACCCTA[T/A]ACAGTAGCAGGAGTAGCTAAGCTGGAAGGGTCAGACGTGCACCCAGAAAA
Long Flanking Sequence:
ACCAGAAAATATGTCAGGGCTGTCCTCACAGGTACATCAAAAATCTAATGCTATCATTTTTATTGCCTTACTAGATCTTTAAGTCCCAGTGAAACACTTTGTGCTATCTTTTCAGATATGAATGTGAGGAATCATTTACGACATTGAATGTAGATATCAGAAACCATCAAAATCTGCTCGATTCTATGGAACAGTATGTGAAAGGGGACTTGCTTGAAGGTGCAAATGCCTACCACTGTGAAAAATGCAACAAGAAGGTGTGTTAACAGTTTTAAGTCATCTTTTGGATGTCCGATGTTTACTAGACAAATGCTGTTAAGCTAAAGCTGGTGATGTGCATCTACATGACAGGTGGACACAGTGAAGCGTTTACTCATTAAGAAGCTTCCTCCGGTGCTGGCCATCCAGTTGAAACGGTTTGATTATGACTGGGAACGAGAGTGTGCCATTAAGTTCAATGACTACTTTGAGTTTCCACGAGAGTTGGACATGGAACCCTA[T/A]ACAGTAGCAGGAGTAGCTAAGCTGGAAGGGTCAGACGTGCACCCAGAAAACCAGGTATTTCACCTAGCCTTTTTCTAGGCCAGTATCAATTTTCTGGTTGTAATTTTTCAGGTCTTTATTACAGTATAATCACAATATTGACCTAAGCTGCAAAAAAAGATTAGAAAATATTTTTAAAAAATGCTTATTGATTAATTGAATATACATACACAGACTAAACAAATGTTTTTTTAAATTGTATTTTCTATTTAATTATTTTTATTTAAATATTTTAGTTAATCATTAAAATCAGCAGTGGGAAATAACCATATTATAATTTTAGCAATGTTTGGGGGGTAATGCATTACAAGTTACTTTTCTAAGTAACAAGTAGCACATTACTTTTAAAAAGTTATTTTTTGAAAATGTAATGTGAGTTACTTTTTAGTTCAATTAGCTTTTAAAAAAATACATTTTTCAATTAAAATTAAAGTCAATGAATCACAGTGAATAAGAGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18951
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025635 Nonsense 1822 2551 34 45
ENSDART00000122803 Nonsense 1826 2594 34 46
ENSDART00000135384 Nonsense 1822 2551 35 46
ENSDART00000025635 Nonsense 1822 2551 34 45
ENSDART00000122803 Nonsense 1826 2594 34 46
ENSDART00000135384 Nonsense 1822 2551 35 46
Genomic Location (Zv9):
Chromosome 9 (position 34336875)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33492821
GRCz11 9 33303567
KASP Assay ID:
2260-2075.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTTCAATGACTACTTTGAGTTTCCACGAGAGTTGGACATGGAACCCTA[T/A]ACAGTAGCAGGAGTAGCTAAGCTGGAAGGGTCAGACGTGCACCCAGAAAA
Long Flanking Sequence:
ACCAGAAAATATGTCAGGGCTGTCCTCACAGGTACATCAAAAATCTAATGCTATCATTTTTATTGCCTTACTAGATCTTTAAGTCCCAGTGAAACACTTTGTGCTATCTTTTCAGATATGAATGTGAGGAATCATTTACGACATTGAATGTAGATATCAGAAACCATCAAAATCTGCTCGATTCTATGGAACAGTATGTGAAAGGGGACTTGCTTGAAGGTGCAAATGCCTACCACTGTGAAAAATGCAACAAGAAGGTGTGTTAACAGTTTTAAGTCATCTTTTGGATGTCCGATGTTTACTAGACAAATGCTGTTAAGCTAAAGCTGGTGATGTGCATCTACATGACAGGTGGACACAGTGAAGCGTTTACTCATTAAGAAGCTTCCTCCGGTGCTGGCCATCCAGTTGAAACGGTTTGATTATGACTGGGAACGAGAGTGTGCCATTAAGTTCAATGACTACTTTGAGTTTCCACGAGAGTTGGACATGGAACCCTA[T/A]ACAGTAGCAGGAGTAGCTAAGCTGGAAGGGTCAGACGTGCACCCAGAAAACCAGGTATTTCACCTAGCCTTTTTCTAGGCCAGTATCAATTTTCTGGTTGTAATTTTTCAGGTCTTTATTACAGTATAATCACAATATTGACCTAAGCTGCAAAAAAAGATTAGAAAATATTTTTAAAAAATGCTTATTGATTAATTGAATATACATACACAGACTAAACAAATGTTTTTTTAAATTGTATTTTCTATTTAATTATTTTTATTTAAATATTTTAGTTAATCATTAAAATCAGCAGTGGGAAATAACCATATTATAATTTTAGCAATGTTTGGGGGGTAATGCATTACAAGTTACTTTTCTAAGTAACAAGTAGCACATTACTTTTAAAAAGTTATTTTTTGAAAATGTAATGTGAGTTACTTTTTAGTTCAATTAGCTTTTAAAAAAATACATTTTTCAATTAAAATTAAAGTCAATGAATCACAGTGAATAAGAGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21524
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025635 Essential Splice Site 2067 2551 36 45
ENSDART00000122803 Essential Splice Site 2073 2594 36 46
ENSDART00000135384 Essential Splice Site 2067 2551 37 46
Genomic Location (Zv9):
Chromosome 9 (position 34341793)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33497739
GRCz11 9 33308485
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTACTGGATTCCACACCAAGAAAATAGTCCGTGGCCCAGCTAGTGATTGG[T/C]AAGCAATTTGTGTTTTAATTACATTGTGTTTCTCAACCATGTTCCTGGAG
Long Flanking Sequence:
TTAGCTATTATAAATTGATATTTCTCTGACATTCAGCCTCATGTTATTGCTTATGCAGAAACCCACTTAAAAGACATCTTTGCACATATGAGTCAAGGCTGCTGTGTGTGCGCGCTTAATTCAATGTTAAAGGCAATCCTGCATAAAAGTCAGACTAATTTATGCCTCCTCCGACCCACCTCTGCTTGTAATATCAAAGTATACAGTTGTAATTGCTGGGCTAATGGATTCATGCCACCTCTGCTGCATTAAACACTCCAAAGACACCTAAATGCCACTTCAGAAGTGCTTCCGTCCCCCTGTGTAAATTTGGCTTTAGAGTTTTCTCTTATGCATCAGCAGTTTCCTCAACTGAGTTTTATTTGTGGCTTTTAGGTCAAGACCACCTTTTGCCTGAAGCAGAGGAGATGGCTATGATCAGTATACAGCTCGCTGCTAGATTTCTCTTCAGTACTGGATTCCACACCAAGAAAATAGTCCGTGGCCCAGCTAGTGATTGG[T/C]AAGCAATTTGTGTTTTAATTACATTGTGTTTCTCAACCATGTTCCTGGAGGTCCACCGACGCAGCATGTTTTGAATGTCTCCTTTGTTTGTCAAACACAATACAGGTCTTAGTCTCTGCTAATTAGCTGATGATCTGAATCAGGTGTGTTTAGTTAAGGAAACGTGTAAAACGTGTAGAGCTGGTTGTCCTCCAGGAACGTGGTTGAGAAACACTGATCAAATTTGAATCTGTTTTTCAGTTTGTTGAACTGTTTATTGACGTTTCAGGTATGATGCTCTGTGCATCTTGTTGAGACACAGTAAGAATGTGCGTTACTGGTTTGCACACAACGTCCTCTTTGCATATCCGAATCGTTTCTCCGAGTACCTGCTTGAGTGCCCCAGTGCAGAGGTTCGAGGGGCCTTCTCCAAACTCATCGTATTCATTGCACATTTCTCCCTGCAAGATGGACCCTGCCCCACACCGATTGCCTCACCTGGACCTTCAAGTCAGGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21525
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025635 Splice Site, Nonsense 2067 2551 37 45
ENSDART00000122803 Splice Site, Nonsense 2073 2594 37 46
ENSDART00000135384 Splice Site, Nonsense 2067 2551 38 46
Genomic Location (Zv9):
Chromosome 9 (position 34342062)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33498008
GRCz11 9 33308754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAATTTGAATCTGTTTTTCAGTTTGTTGAACTGTTTATTGACGTTTCAG[G/A]TATGATGCTCTGTGCATCTTGTTGAGACACAGTAAGAATGTGCGTTACTG
Long Flanking Sequence:
AAATGCCACTTCAGAAGTGCTTCCGTCCCCCTGTGTAAATTTGGCTTTAGAGTTTTCTCTTATGCATCAGCAGTTTCCTCAACTGAGTTTTATTTGTGGCTTTTAGGTCAAGACCACCTTTTGCCTGAAGCAGAGGAGATGGCTATGATCAGTATACAGCTCGCTGCTAGATTTCTCTTCAGTACTGGATTCCACACCAAGAAAATAGTCCGTGGCCCAGCTAGTGATTGGTAAGCAATTTGTGTTTTAATTACATTGTGTTTCTCAACCATGTTCCTGGAGGTCCACCGACGCAGCATGTTTTGAATGTCTCCTTTGTTTGTCAAACACAATACAGGTCTTAGTCTCTGCTAATTAGCTGATGATCTGAATCAGGTGTGTTTAGTTAAGGAAACGTGTAAAACGTGTAGAGCTGGTTGTCCTCCAGGAACGTGGTTGAGAAACACTGATCAAATTTGAATCTGTTTTTCAGTTTGTTGAACTGTTTATTGACGTTTCAG[G/A]TATGATGCTCTGTGCATCTTGTTGAGACACAGTAAGAATGTGCGTTACTGGTTTGCACACAACGTCCTCTTTGCATATCCGAATCGTTTCTCCGAGTACCTGCTTGAGTGCCCCAGTGCAGAGGTTCGAGGGGCCTTCTCCAAACTCATCGTATTCATTGCACATTTCTCCCTGCAAGATGGACCCTGCCCCACACCGATTGCCTCACCTGGACCTTCAAGTCAGGTGTGTGATTTTAGTAAAGTTACCATCTCTATAGGTTGTGTGCCATCACGTGGTTCTGTTGACGCGCGGAATTCAGATGGAGGTCTGTGTTTTTGCTAGTTTTAAAGGAGATATAAAAAGAAAATAAGCACATATGTTGGGCATGATCCTTATCATGAAGACTGCCAAGTTTGCTACTGAACTATAATATATTTTCCTGTCATTAATGTGGTAGATACTGTATAAGCTATTATGTTACATGAAAGTACTATAGTAAATACTGTAGTGTTTGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16185
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025635 None None 2551 None 45
ENSDART00000122803 Essential Splice Site 2516 2594 44 46
ENSDART00000135384 None None 2551 None 46
Genomic Location (Zv9):
Chromosome 9 (position 34346923)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33502869
GRCz11 9 33313615
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACACAGCAGCTTTTGCCAGGGGAAGTGACAGGCCCACAACAGCACACCG[T/C]AAGACTCKTTTGGCCCAGCCACACTGGTGCATCTGCGTAACTTTTTGGTG
Long Flanking Sequence:
CTCATACCGTGACTTTTTAATGATGGGCAGGCACACATATCCAACATTTGGATAATATTTTTGGAAGAAATTAGTGCTCAATCACTACATTTAACTATAGGTAGGGCTTTGAGTTTTCGACTTTATTTTTATTATTATTTCCAGGTTTTTTTTTTATATGTAGGTTATATAATGCAGGCCTTTTTAAATGCTTTTGGTGTTTGCGTATATTTAAGTTTCATTCTATTGTAATTTAGTTATTGTTTATCATTTTTAATAATTTGCTGAACTAAAACGCTTGCTCTTATCCAGTAAACTCATTCAATAGCTGACCACAGATGTGAAATGTATGCAGCCGTAGATGCATAATTTGTTGGAAAAGTATGCAATATTAACTGCCGTTTCAAAATAGTGTCACTTAACGAAGCACGAGGTGGTTTCTGAAGAGGACGCTGGCCGGAACCCGTCCTCCACACAGCAGCTTTTGCCAGGGGAAGTGACAGGCCCACAACAGCACACCG[T/C]AAGACTCGTTTGGCCCAGCCACACTGGTGCATCTGCGTAACTTTTTGGTGTTCACAGGGCGTGATGTAGACAAGAACCATCTTCCACCTCCCTCAAAAACAACTCTCAATCAGCTGTTACTGCGTCCTCATCTCAGTGTGTCCAAACTGTTTCTTTTGACCCAACTAGAAGTACTAATGTGCTACGTGATCGAAAACTCTAAGCCTTGGCTATAGTGTACAGATGAGTTGGAGGTCATTTTTTGTGTCTGGTGGTCTTTTTTTTTCTTTTGAGTTTGTGAAACTGTTTTAATCATTTAGTCCAAAAATATCCTGTATTAAGAAGCTTTTGGGTGACTGCAAATTTTTGCCCCTTTAAATGGGTTTAATCACCCAAAAATGCTAATTCTGTCATTTTGCTGTCATCTTTCTAAATGAAAGACTTTTGTTCTTGATCTTGAACGCATGATAGAAAATTAGGTTACTAAATGTCTGCCCCTCCATTCAGATGCTGTTCTCCCA
Associated Phenotype:
Not determined