Busch Lab

ZMP

LOC560607

Ensembl ID:
ENSDARG00000013649
Human Orthologue:
CASR
Human Description:
calcium-sensing receptor [Source:HGNC Symbol;Acc:1514]
Mouse Orthologue:
Casr
Mouse Description:
calcium-sensing receptor Gene [Source:MGI Symbol;Acc:MGI:1351351]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20589 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20589
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010934 Nonsense 137 944 2 6
Genomic Location (Zv9):
Chromosome 5 (position 71194751)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67098524
GRCz11 5 67776893
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATTCACTGAATCTGGACGAGTTCTGTAACTGCACAGGGAACATCCCAT[C/A]AACCATTGCAGTGGTCGGGGCTTCTGGATCTGCAGTGTCTACTGCCGTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26630
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010934 Nonsense 741 944 6 6
Genomic Location (Zv9):
Chromosome 5 (position 71202553)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67090722
GRCz11 5 67769091
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTGCGTGGTTTGGTTGTACAACGCTCCGCCTGGAAGTTACAAGAACTA[C/A]GACATCGATGAAATCATCTTCATCACCTGCAACGAGGGCTCCATGATGGC
Associated Phenotype:
Not determined