Busch Lab

ZMP

sema3gb

Ensembl ID:
ENSDARG00000013607
ZFIN ID:
ZDB-GENE-050513-4
Description:
semaphorin 3gb [Source:RefSeq peptide;Acc:NP_001014824]
Human Orthologue:
SEMA3F
Human Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F [Source:HGNC
Mouse Orthologue:
Sema3f
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F Gene [Source:

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34391 Nonsense Mutation detected in F1 DNA Not yet available
sa21283 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27195
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026316 Essential Splice Site 146 746 4 17
ENSDART00000129378 Essential Splice Site 146 745 4 17
Genomic Location (Zv9):
Chromosome 8 (position 24395439)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23521257
GRCz11 8 23542496
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTTACAAACCCATCTGCACCTTCATCAACAGAGGCTGGAGAGCTGAGG[T/G]ACACACACACACACACACACACCCACACACCCACACACACACTGTAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34391
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026316 Nonsense 156 746 5 17
ENSDART00000129378 Nonsense 156 745 5 17
Genomic Location (Zv9):
Chromosome 8 (position 24396418)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23522236
GRCz11 8 23543475
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGATTATGTGTAGGAATACCTCTTCCGGCTGGTTCCTGGTTA[T/A]GTGGACTCTGGAAAAGGAAAGTCTCCTTATGATCCCCGGCAGGAGAACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21283
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026316 Nonsense 408 746 11 17
ENSDART00000129378 Nonsense 408 745 11 17
Genomic Location (Zv9):
Chromosome 8 (position 24400714)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23526532
GRCz11 8 23547771
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTCTCAGACGAGGCTGTAAACTTTGTCCGTGCCCATCCGCTGATGTAC[C/T]AACCTATATATCCCATACACAAGCGCCCCCTGGTGGTCAGGACTGGAGTC
Associated Phenotype:
Not determined